ORFeome > dad1 ORF1 – XORFeome v1.0

dad1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dad1
Gene ID: 922833
Gene Page ID: 922820
ORF Xenbase ID: 17271759

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078613
Original XGC clone length: 342

Human orthology & disease relationships

NCBI Entrez ID: 1603
Ensembl gene IDs: ENSG00000129562
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ839836
dbEST ID: 79657538
Trimmed Sequence: ATGTCAGTTTCCGTGTTTTCGGTAGTTTCTCGGTTCTTAGATGAATATGTCAGCTCCACTCCGCAGCGGCTCAAGCTACTGGACGCTTACTTGCTCTACATCCTGCTGACCGGCGCTTTGCAGTTCTTGTACTGCCTGCTGGTTGGGACCTTCCCTTTCAACTCCTTCTTGTCCGGCTTCATATCCTCCGTGGGCTCATTCATCCTTGCCGTGTGTTTAAGGATCCAGATAAATCCACAGAACAAAAGCGACTTCCAGGGGATATCACCAGAGAGAGCTTTTGCAGACTTTCTCTTTGCCAACACTATTTTACACTTGGTTGTCGTTAATTTTATTGGTTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGTTTCCGTGTTTTCGGTAGTTTCTCGGTTCTTAGATGAATATGTCAGCTCCACTCCGCAGCGGCTCAAGCTACTGGACGCTTACTTGCTCTACATCCTGCTGACCGGCGCTTTGCAGTTCTTGTACTGCCTGCTGGTTGGGACCTTCCCTTTCAACTCCTTCTTGTCCGGCTTCATATCCTCCGTGGGCTCATTCATCCTTGCCGTGTGTTTAAGGATCCAGATAAATCCACAGAACAAAAGCGACTTCCAGGGGATATCACCAGAGAGAGCTTTTGCAGACTTTCTCTTTGCCAACACTATTTTACACTTGGTTGTCGTTAATTTTATTGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCATATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAAAAAAAAAATAAAAAAAATTAAAAAAAAAAAGGGCTCCTCAGACAACAAAAAAAAAAAAAACCACAAAATAAAAACCCTTTTGGGGGGGGGTGCGCGGGGAGGGGAAAAAGAGGAAAAACCCCCGGAAACGAGTTTGTTGTGGGGGGGGGAAGGGGGGGGGGGGGGGCCCCCCCGCGCCCCCCCCCCTCCGGGAAACACGGCGGTGGGGGGGGGGGGGGGGGGGGGTGTTTGGTGTGGTTGTGTTTTTTTTTTTTTCTCTCTCACAATCCTTCTCCCCACACACAACCACACCCCAACAGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGTTTCCGTGTTTTCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839835
dbEST ID: 79657537
Trimmed Sequence: ACCAATAAAATTAACGACAACCAAGTGTAAAATAGTGTTGGCAAAGAGAAAGTCTGCAAAAGCTCTCTCTGGTGATATCCCCTGGAAGTCGCTTTTGTTCTGTGGATTTATCTGGATCCTTAAACACACGGCAAGGATGAATGAGCCCACGGAGGATATGAAGCCGGACAAGAAGGAGTTGAAAGGGAAGGTCCCAACCAGCAGGCAGTACAAGAACTGCAAAGCGCCGGTCAGCAGGATGTAGAGCAAGTAAGCGTCCAGTAGCTTGAGCCGCTGCGGAGTGGAGCTGACATATTCATCTAAGAACCGAGAAACTACCGAAAACACGGAAACTGACATGG
Full Trace Sequence: GGGAAAACGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCAATAAAATTAACGACAACCAAGTGTAAAATAGTGTTGGCAAAGAGAAAGTCTGCAAAAGCTCTCTCTGGTGATATCCCCTGGAAGTCGCTTTTGTTCTGTGGATTTATCTGGATCCTTAAACACACGGCAAGGATGAATGAGCCCACGGAGGATATGAAGCCGGACAAGAAGGAGTTGAAAGGGAAGGTCCCAACCAGCAGGCAGTACAAGAACTGCAAAGCGCCGGTCAGCAGGATGTAGAGCAAGTAAGCGTCCAGTAGCTTGAGCCGCTGCGGAGTGGAGCTGACATATTCATCTAAGAACCGAGAAACTACCGAAAACACGGAAACTGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCGACCTTAATACTGTCCAGTCAATTACAAAAAAAAAACAGAGCTGTTTCATGACAGCTCTGGCCCGTGTCAAAAAAAAAAAAAAAAAAAATAAAAATAAACTCTTGTTTGTGGGTGTGTTCCGGGGGAAAACAAAAAAAAAAAAAAAAACCCCACAAAAGAATTCTTTTTTTTTTTTTTGTGTGGGGGGGGGGGGGGGGGCCCCCCCTCTCGGAAAGAAAAAAAAAAAACCGGGGGGGGGGGGGGGTGTGGGGGTTGGGTTGGTTGTTGGGGTGTGTGTTGTGTGTGGGTTCTTTCTCTTTCCCGTGTCCCCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAATAAAATTAACGACAACCA