ORFeome > dapl1 ORF1 – XORFeome v1.0

dapl1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dapl1
Gene ID: 6255499
Gene Page ID: 1014846
ORF Xenbase ID: 17271819

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133256
Original XGC clone length: 342

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ840196
dbEST ID: 79657898
Trimmed Sequence: ATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCCCCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAAATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAAATGTTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCCCCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAAATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAAATGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCAAAACCAAAAATCAAAATCTCATAATGTTACACCGCGCAAGAGACGGGGGGAAAAAGAGTACAAAAAAAAAATAAAAAAAAAGAAAGGGGTGTTTCCTCTCTTCGGTTTTTTATGAGGGGAGGCCGACAAAAAAAAAAAAAAACTCCCGGCTGGCAAAACTTAAAGGTGGGGGAGGGGAAACCCCAACACAGGGGGAAAAAAATATATAAAGAACCACCCCACGGGGGGGAGGAGAAAAAGGGGGGTTTTTTTGTGTGTTTTAAAAAAAAAATTTTTGTTGAAAGAAACCGAAAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTAAAGAGCTGAAAGTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ840195
dbEST ID: 79657897
Trimmed Sequence: ACATCTGCGAGGCTGTTGAATAAGGTAGAGCCTTTTTGGCATAATGATCTTCTCAACGGTAGGTCTGGGCTTTTGGTGCGCAATCTGTGCTGCTTCTCCAGGAAAGTCATGGCTGAGCTTCTCTAGCTCACCAGCCAATATATTCATTGCTTGCATCTTCGTCATGTTAAGAACAGAGCTTGGTTTCTCCTGCAAGGTTTTCTTTGCATTTTTCTCANGGGCACTGTTTTCATCGTTACCTTGCTTTTTGGAAACCCTCATTCCTCCNGCTTTCACTGCAGGGAGATGACCAGCCTTTACGGCTTGGGGAGAACTCTGCACTTTCAGCTCTTTAGTCATGG
Full Trace Sequence: GGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAANAAAGTTGGCAAACATCTGCGAGGCTGTTGAATAAGGTAGAGCCTTTTTGGCATAATGATCTTCTCAACGGTAGGTCTGGGCTTTTGGTGCGCAATCTGTGCTGCTTCTCCAGGAAAGTCATGGCTGAGCTTCTCTAGCTCACCAGCCAATATATTCATTGCTTGCATCTTCGTCATGTTAAGAACAGAGCTTGGTTTCTCCTGCAAGGTTTTCTTTGCATTTTTCTCANGGGCACTGTTTTCATCGTTACCTTGCTTTTTGGAAACCCTCATTCCTCCNGCTTTCACTGCAGGGAGATGACCAGCCTTTACGGCTTGGGGAGAACTCTGCACTTTCAGCTCTTTAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAACAAACCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGGGGCCCAAGTAAAAAACAAAAAAAAAAATAAAAAACTTTGCCCACAGAAGGGGAGTGCGGAGGGAAGGGAACACATAAAATACAACCAAAAAAAGTGGGGCGTTCGGTCCTTCGGTTGTGAAGAGGGGACGACCCCCGTGAACAACACCAGTCTCCGGGGACGCGCTTGAGGCTGGGGGGGTGGCGCCCCCTGAGGGGGGCCCAGAAACGGTGGCCAAACCAAAGGGGGGATCCCCGCAAAGGGGGGTTTTGGGTGTTGTTTTTGTGGGTTTTATATGTTTTTTTCCTCTCCCNTGACCCCCACACGCCGGCACGCCAGGAACCCCCTGCGGTTCGCGGAATTTTGGTTGTATGTGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACATCTGCGAGGCTGTTGAA