ORFeome > dapl1 ORF2 – XORFeome v1.0

dapl1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dapl1
Gene ID: 1014852
Gene Page ID: 1014846
ORF Xenbase ID: 17271825

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133188
Original XGC clone length: 342

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ838598
dbEST ID: 79656300
Trimmed Sequence: ATGGCTAAAGAGCAGAAAATGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCACCTTCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAACAAGGTAACGAAGAAAACAGTGCGCCCGAGAAAAACGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCGCGGCCTACTGTTGAGAAGACCATTCTGCCGAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTT
Full Trace Sequence: GGGGCCCTTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAAAGAGCAGAAAATGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCACCTTCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAACAAGGTAACGAAGAAAACAGTGCGCCCGAGAAAAACGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCGCGGCCTACTGTTGAGAAGACCATTCTGCCGAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAAATCTGGAAAATGTCTCAAAATCTCTGATGTTACATGGGCGGCTGGGGGGGGTTCGTTTATTTTAGCGCCTACCAAGAAAAGAGGGGCAGCATCTTGGTATTGTTTGGGTGTAAACCCCCACTAAACTAACCAAATTCGCTGGTAACCTTTTATCCATATGGTCCCCCGGGCGGAAGGGGGGGGCAAAATCTGAGCAGAGGAAGGGGGGGTGAGAGGGCGCGCGGGNTCCTTGGGGGGGTATAAAACGCTTTTTTTTGGGNGAN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAAAGAGCAGAAAATGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838597
dbEST ID: 79656299
Trimmed Sequence: ACATCTGCGAGGCTGCTGAATAATGTAGAGCCTTTTCGGCAGAATGGTCTTCTCAACAGTAGGCCGCGGTTTTTGATGCGCAATCTGTGCGGCTTCTCCAGGAAAGTCGTGGCTGAGCTTCTCTAGCTCTCCAGCCAAAATATTCATTGCTTGCATCTTTGTCATGTTAAGAACAGAGCTTGGTTTCTCCTGCAAGGTTTTCTTTGCGTTTTTCTCGGGCGCACTGTTTTCTTCGTTACCTTGTTTTTTGGAAACCCTCATTCCTCCAGCTTTCACTGCANGAAGGTGACCAGCCTTTAGGGCTTGGGGAGAACTCTGCATTTTCTGCTCTTTAGCCATGG
Full Trace Sequence: AAAGGTCTATTGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACATCTGCGAGGCTGCTGAATAATGTAGAGCCTTTTCGGCAGAATGGTCTTCTCAACAGTAGGCCGCGGTTTTTGATGCGCAATCTGTGCGGCTTCTCCAGGAAAGTCGTGGCTGAGCTTCTCTAGCTCTCCAGCCAAAATATTCATTGCTTGCATCTTTGTCATGTTAAGAACAGAGCTTGGTTTCTCCTGCAAGGTTTTCTTTGCGTTTTTCTCGGGCGCACTGTTTTCTTCGTTACCTTGTTTTTTGGAAACCCTCATTCCTCCAGCTTTCACTGCANGAAGGTGACCAGCCTTTAGGGCTTGGGGAGAACTCTGCATTTTCTGCTCTTTAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAAACAAAAAAATGAAAACAGAACCATAGTTTTACATCGCCGAGACTAGGCACCGGGAGGGGATCGAATAGACTACCGGGCTACCCAGAGTACGGGGTCATGCGTTTCATGGGATGTTAGGAGGGGAAGAATCCAGTGAGCAGACCCTGGTTCGGGTGATAGGCGTAAGGCCATGTAACAATGGGTCCCCGGGACTGGGTTCCAGAATCTTGAGCGGGAGGGGGGGGGGGGGAAGGGCCCGCCGTGGGGTTTAAAGGGGTGGANAAAACGGTTTTTTTGGGGGAAAAAAAAAGNACGCGNGGGGAGGGGGGAGAAAACNNAGANT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACATCTGCGAGGCTGCTGAA