ORFeome > dars-prov ORF1 – XORFeome v1.0

dars-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256600
Gene Page ID:
ORF Xenbase ID: 17271843

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042227
Original XGC clone length: 1593

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11015
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ824270
dbEST ID: 79641972
Trimmed Sequence: ATGACTAAGGAGGAGGCCAAAGGTGCGTCCAGCGAGGACCAAGCTCAGTCCAAGAAAGCTCTCAAGAAACAACAGAAGGAAGCTGAAAAAGCTGCTAAGAAAGCTGAGAAACAGGCCAAATTGGCATCTGAACAACATGCAGAAGAGGAAGAGGACTTTGCTAAAGAGAGATATGGTGTCCCTTCAATGATCCAGTCTCAAGACAAGCCAGATCGGGTGCTAGTGCGGGTGAAGGACCTCACTGTACAGATAGCTGATGAAACCGTCTGGGTCCGCTCCAGGGTTCACACCAGCAGGGCAAAAGGAAAGCAGTGCTTCTTGGTTCTTCGTCAGCAGCAGTTTAATGTGCAAGCTCTGGTGGCGGTAGGAGAGCGCGCAAGCAAGCAGATGGTGAAGTTTGCTGCCAACATCACAAAAGAAAGCATTGTTGACGTGGAAGGAGTCGTGCGCAAGGTAGATCAGAAGATCGAGAGCTGTACCCAACAAGACGTGGAGCTTCACATTGAGAGAATCTATGTCATCAGTGCTGCTGAGCCTCGACTGCCCCTCCAGCTTGAAGATGCTGTGCGTCCTGAGACGGAAGGAGAAGAGGAAGGAAGAGCGACTGTAAACCAGGATACCAGACTCGACAATAGAGTCATTGATTTAAGAACTTCCACCAGCCAGGCCCGTGTTTGGTCTCCAGTCAGGTATCTGCCAGCTCTTCAGAGATACCCTCACTNAATAAGGCTTTGGGGGAGATCCAGAACCCAAAAAATCATTTTCTGCTGGCCAGTGAAGGGAGGGTGGCCAATGGGGTTCAACCGGTTTTCCCTATTTTTTAAA
Full Trace Sequence: CAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTAAGGAGGAGGCCAAAGGTGCGTCCAGCGAGGACCAAGCTCAGTCCAAGAAAGCTCTCAAGAAACAACAGAAGGAAGCTGAAAAAGCTGCTAAGAAAGCTGAGAAACAGGCCAAATTGGCATCTGAACAACATGCAGAAGAGGAAGAGGACTTTGCTAAAGAGAGATATGGTGTCCCTTCAATGATCCAGTCTCAAGACAAGCCAGATCGGGTGCTAGTGCGGGTGAAGGACCTCACTGTACAGATAGCTGATGAAACCGTCTGGGTCCGCTCCAGGGTTCACACCAGCAGGGCAAAAGGAAAGCAGTGCTTCTTGGTTCTTCGTCAGCAGCAGTTTAATGTGCAAGCTCTGGTGGCGGTAGGAGAGCGCGCAAGCAAGCAGATGGTGAAGTTTGCTGCCAACATCACAAAAGAAAGCATTGTTGACGTGGAAGGAGTCGTGCGCAAGGTAGATCAGAAGATCGAGAGCTGTACCCAACAAGACGTGGAGCTTCACATTGAGAGAATCTATGTCATCAGTGCTGCTGAGCCTCGACTGCCCCTCCAGCTTGAAGATGCTGTGCGTCCTGAGACGGAAGGAGAAGAGGAAGGAAGAGCGACTGTAAACCAGGATACCAGACTCGACAATAGAGTCATTGATTTAAGAACTTCCACCAGCCAGGCCCGTGTTTGGTCTCCAGTCAGGTATCTGCCAGCTCTTCAGAGATACCCTCACTNAATAAGGCTTTGGGGGAGATCCAGAACCCAAAAAATCATTTTCTGCTGGCCAGTGAAGGGAGGGTGGCCAATGGGGTTCAACCGGTTTTCCCTATTTTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTAAGGAGGAGGCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829596
dbEST ID: 79647298
Trimmed Sequence: TGGGGTCAGTCTTTTAGGGTCACGTGGGAACATGGAGGTCTGGCGGACATTGTGCAGCCCCAAATACAGCATGGTTACGCGTTCCAGACCTATGCCACCGCCGGCGTGAGGAGGAGCTCCAAAACGGAAAGAGTCTATGTAAGCCTTAATTTTCTCCAAGTCAATACCATGGTGCGTGGCCCTATCAGTGAGCAGCTGAGGATCATGGACTCTCTGGGCTCCCGACAAGATCTCCTCTCCTCTCATAAACATATCATATGAGTTGGAGTATTTAGGATTATTTGGATCAGGCATGGTGTAGAAGGGTCGGACAGCCAGCGGATATTTATCCAGGATGTAGAAGTCAGTGTCATACTTCTCTTTCACCAGGCGCCCCAAAAGCTTCTCATTCGGTGTGCTGAGATCCTCTTCATCTCCCATCTCCACTCCTGCTTCCCGCAGCATGGCAACGCCTTCAGTGTACTCTAGACGCAAGGTCGGCTCAAGGAATTTGAATGGCTCACAAGGGAACTGCTTGCACACTGTCTGAATCTCAGTCTGGAATCTTTCTTGAAGCCCTTTGAAAATCTGGACCAGGGTGTCTGCAATCTCATCAACGACCTCATGGTAGTGGTAAATTAAATGCCATTTCTATATCCAGACCAACAAAACTCAGTCAAGGTGCCCGATGGAGTGTTTTGAAGTTCTTCTGCCACCGGAAATAACTGGGCCCAAAATACAAAAATAACTTT
Full Trace Sequence: CTGCCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGGGTCAGTCTTTTAGGGTCACGTGGGAACATGGAGGTCTGGCGGACATTGTGCAGCCCCAAATACAGCATGGTTACGCGTTCCAGACCTATGCCACCGCCGGCGTGAGGAGGAGCTCCAAAACGGAAAGAGTCTATGTAAGCCTTAATTTTCTCCAAGTCAATACCATGGTGCGTGGCCCTATCAGTGAGCAGCTGAGGATCATGGACTCTCTGGGCTCCCGACAAGATCTCCTCTCCTCTCATAAACATATCATATGAGTTGGAGTATTTAGGATTATTTGGATCAGGCATGGTGTAGAAGGGTCGGACAGCCAGCGGATATTTATCCAGGATGTAGAAGTCAGTGTCATACTTCTCTTTCACCAGGCGCCCCAAAAGCTTCTCATTCGGTGTGCTGAGATCCTCTTCATCTCCCATCTCCACTCCTGCTTCCCGCAGCATGGCAACGCCTTCAGTGTACTCTAGACGCAAGGTCGGCTCAAGGAATTTGAATGGCTCACAAGGGAACTGCTTGCACACTGTCTGAATCTCAGTCTGGAATCTTTCTTGAAGCCCTTTGAAAATCTGGACCAGGGTGTCTGCAATCTCATCAACGACCTCATGGTAGTGGTAAATTAAATGCCATTTCTATATCCAGACCAACAAAACTCAGTCAAGGTGCCCGATGGAGTGTTTTGAAGTTCTTCTGCCACCGGAAATAACTGGGCCCAAAATACAAAAATAACTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGGGTCAGTCTTTTAGGGT