ORFeome > dbi ORF2 – XORFeome v1.0

dbi ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dbi
Gene ID: 6256171
Gene Page ID: 6453955
ORF Xenbase ID: 17271879

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC128948
Original XGC clone length: 351

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ838968
dbEST ID: 79656670
Trimmed Sequence: ATGTCCTATGACTATTCTACCAAGGAGATGCCATATGTCTCATTACTGACCCCTGCTGGACACTCCACCTCCTCACTGTTTTTGCCCTCCCTTCCAGGCAGCGTTTGAGAAGGCAGCAGAGGAGGTGAAGCAGCTAAAATCTACACCCGCAGATGAGGAAATGCTGGAGACTTATGCCCTGTACAAGCAGGCCACTGTCGGGGATGTAAATACAGACCGTCCTGGAATGCTGGACTTCAAAGGCAAAGCCAAGTGGGATGCCTGGAACAAGAAAAAAGGAACCAGCAAGGAGGATGCCATGGCCCAGTATGTGGAGTTCGTTGAAAAGCTAAAGGGCAAATATGGATGCTT
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTATGACTATTCTACCAAGGAGATGCCATATGTCTCATTACTGACCCCTGCTGGACACTCCACCTCCTCACTGTTTTTGCCCTCCCTTCCAGGCAGCGTTTGAGAAGGCAGCAGAGGAGGTGAAGCAGCTAAAATCTACACCCGCAGATGAGGAAATGCTGGAGACTTATGCCCTGTACAAGCAGGCCACTGTCGGGGATGTAAATACAGACCGTCCTGGAATGCTGGACTTCAAAGGCAAAGCCAAGTGGGATGCCTGGAACAAGAAAAAAGGAACCAGCAAGGAGGATGCCATGGCCCAGTATGTGGAGTTCGTTGAAAAGCTAAAGGGCAAATATGGATGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGGCNACACAAAAAAAAAAAAAAAAATCAAAAAATTTTACACCGCCGCCCCGGACACCCCGGGAAAAAAACACAAAAAAAAACTCCCCCAAAGGGGGCGGGTGGTCCTTTTTTGTTTAAGGAGAAAGGCGGACCACCAAGGAAAATACCCTTTGGGGGGTGTATAATGTGAGTGGGAGGGGACGCCCCCCCGCACGTGGCGACAAAATATTACCCCACCCCCCGTTTGGTGGAGGGCAGTGGGTTTTTTTTTTTTTTTTTTTTTTATTTTTTTTTTTTATTACACACACGCCCCCCGCCCCCCCCCACACAGCCCGCGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTATGACTATTCTACCAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838967
dbEST ID: 79656669
Trimmed Sequence: GCATCCATATTTGCCCTTTAGCTTTTCAACGAACTCCACATACTGGGCCATGGCATCCTCCTTGCTGGTTCCTTTTTTCTTGTTCCAGGCATCCCACTTGGCTTTGCCTTTGAAGTCCAGCATTCCAGGACGGTCTGTATTTACATCCCCGACAGTGGCCTGCTTGTACAGGGCATAAGTCTCCAGCATTTCCTCATCTGCGGGTGTAGATTTTAGCTGCTTCACCTCCTCTGCTGCCTTCTCAAACGCTGCCTGGAAGGGAGGGCAAAAACAGTGAGAGGTGGAGTGTCCAGCAGGGGTCAGTAATGAGACATATGGCATCTCCTTGGTAGAATAGTCATAGGACATGG
Full Trace Sequence: GGGAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCATCCATATTTGCCCTTTAGCTTTTCAACGAACTCCACATACTGGGCCATGGCATCCTCCTTGCTGGTTCCTTTTTTCTTGTTCCAGGCATCCCACTTGGCTTTGCCTTTGAAGTCCAGCATTCCAGGACGGTCTGTATTTACATCCCCGACAGTGGCCTGCTTGTACAGGGCATAAGTCTCCAGCATTTCCTCATCTGCGGGTGTAGATTTTAGCTGCTTCACCTCCTCTGCTGCCTTCTCAAACGCTGCCTGGAAGGGAGGGCAAAAACAGTGAGAGGTGGAGTGTCCAGCAGGGGTCAGTAATGAGACATATGGCATCTCCTTGGTAGAATAGTCATAGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACAAAAAAAACAAAAACAACTACAATAAATGACCGGCCACTTGGGAACCGCCCGGAAAAAAAAAAAAAAAAACCCCACCTCCAACAAGGTGGCGTTGTGTAACATCGTGGTGGGTGGAGGAGGCCACCACAAGAGGGAGAAGACTCCCCGGGGAAGTGGTAATGGGTGGTGGATTATTTTCGTGGGGCGTCCGCCNNGGGGGGGCAACACCTTTGGGAGAGAGGGGGTGGGGGGGCGGTGGCGGCGGGTGGGGGGTTTCTATTGGTTGTNGTTTCATGGATGGGTTGTGGTGNNGNNNGGANNCGGTGTTTGAGCGCNCGNGAANNAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATCCATATTTGCCCTTTAGCTT