ORFeome > dbnl-prov ORF1 – XORFeome v1.0

dbnl-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256638
Gene Page ID:
ORF Xenbase ID: 17271897

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044296
Original XGC clone length: 1344

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ824134
dbEST ID: 79641836
Trimmed Sequence: ATGTCAGTGAATCTAAGTAAGAACGGGGCCGCCTTGCAGGGCGCTTATAAAGATGTGCTGGATGAAAAGACCAAAACCGACTGGGCTCTTTATACATATGAAGGTAACAGTAATGACATCCGATTGGCCGAAACTGGAGATGGGGGGCTTGAAGAGCTAGTGGAAGAACTGAGCAGCGGTAAAGTGATGTACGCCTTCTGCAGGGTGAAAGACCCCAACTCCGGACTTCCAAAGTTTGTCCTCGTTAACTGGACAGGCGAGGGTGTGAAAGATGCCCGGAAAGGGGCGTGTGCCAACCATGTCAGCACAATGGCCAACTTCCTCAAGGGTGCCCATGTTACAATTAATGCCCGTGCTGAAGAGGATGTAGAGCCAGAGAGCATCATGGAAAAGGTGGCCAAAGCATCTGGGGCCAACTACAACTTCCACAAGGAGAGTAAAAGGGGCAACGAGGGACCTCAGGGACCAGTGGGTTCGGTCTATCAGAAAACCAATGCAATGTCAGAAATTAAACGCGTGGGAAAAGAGAATTTCTGGGCTAAGGCAGAGAAAGATGAAGAAGAACGAAGAATGGAGGAAAATAGGAGGGCAAACTCAGAAAAAGATCGGCTGGAGAGGGAGCGCAAGGAGAGAGAGCAGAAGGGAGGCTGAGACAAGAGAGCAGAAGTTCCGGGGAGAGGGNCAAGGGAGATAGATGCACAGAGGAAAGAGCAGGAAGAAACAGAAAACAGCCAGAACGGTTCCTGCCTTCCCACCCTCTGTTTACCCCCCTTTGAAACTCTCCTTCAAAGAAAGCCTCCATACCTGATTTTTGGCGCCCATGAAGGCCCACCCCGGGGGG
Full Trace Sequence: TACTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGTGAATCTAAGTAAGAACGGGGCCGCCTTGCAGGGCGCTTATAAAGATGTGCTGGATGAAAAGACCAAAACCGACTGGGCTCTTTATACATATGAAGGTAACAGTAATGACATCCGATTGGCCGAAACTGGAGATGGGGGGCTTGAAGAGCTAGTGGAAGAACTGAGCAGCGGTAAAGTGATGTACGCCTTCTGCAGGGTGAAAGACCCCAACTCCGGACTTCCAAAGTTTGTCCTCGTTAACTGGACAGGCGAGGGTGTGAAAGATGCCCGGAAAGGGGCGTGTGCCAACCATGTCAGCACAATGGCCAACTTCCTCAAGGGTGCCCATGTTACAATTAATGCCCGTGCTGAAGAGGATGTAGAGCCAGAGAGCATCATGGAAAAGGTGGCCAAAGCATCTGGGGCCAACTACAACTTCCACAAGGAGAGTAAAAGGGGCAACGAGGGACCTCAGGGACCAGTGGGTTCGGTCTATCAGAAAACCAATGCAATGTCAGAAATTAAACGCGTGGGAAAAGAGAATTTCTGGGCTAAGGCAGAGAAAGATGAAGAAGAACGAAGAATGGAGGAAAATAGGAGGGCAAACTCAGAAAAAGATCGGCTGGAGAGGGAGCGCAAGGAGAGAGAGCAGAAGGGAGGCTGAGACAAGAGAGCAGAAGTTCCGGGGAGAGGGNCAAGGGAGATAGATGCACAGAGGAAAGAGCAGGAAGAAACAGAAAACAGCCAGAACGGTTCCTGCCTTCCCACCCTCTGTTTACCCCCCTTTGAAACTCTCCTTCAAAGAAAGCCTCCATACCTGATTTTTGGCGCCCATGAAGGCCCACCCCGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGTGAATCTAAGTAAGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829441
dbEST ID: 79647143
Trimmed Sequence: CTCGAGTAGCTCGACATAATTGGCTGGAAACATTCCAAAGTGACCAGCGGGGCTAAAACCGCGCCACCAGCCTTCGTCAATAAACTGAATTTGTGTTATTAAGTCATCTGGGTCAAATGAGATCTCGGTATCATCCGCTGCTTGGTAGTCATACAGTGCCCGTGCGCAGACTCCTTTCTCTTCCTCCACTTCAATCTCATACACTGGTTCCTCCTGGGGTGTATCCTCATATATATTTTGGTTCTCAGTGGTATCCTCATATATATTTTGGTCCTCAGTGGCATCCTGGTATATATTCTCTTCTTCTTGCTGGGAGGCAGTACATTGCTCTTTCACATGGACAGTGGACTCTGGTGGATGAGAGACAGGGGGCACAGGAGATTCTGGGGGTGTCTGGTGAGCAGGATACACAGGGGGTGATGGGGGTTCCTGGACACGATGTACAGGGGACGGAGGAGGAGAAGACTCAGGCTGACAAGCCGACTTCTGCAAGAAGGGACTGCGCAGCCTCCCAGGCTGGGCACTCACTGGGCCAGACTCAGGTAATGAGCGCTCTTTCTGAAGGAACGTCTCACGTGGGTTAACAGAGCGCTGGGAGGCAGGAACCGTCTGCTGTTTCTCTGTTTCCCCTTGCTCTTTCCTCTGTGCATCTATCTCCTTTTCCCCTCTCCCGGACCCCCGGGCTCTCTTGGTCCCACCCCTCCCCTCCGCCTCTTCTCTCCCTTGGCCCCTCCTCTCCTCCCACCCAAAATCTTTTTTTCTGA
Full Trace Sequence: TGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGAGTAGCTCGACATAATTGGCTGGAAACATTCCAAAGTGACCAGCGGGGCTAAAACCGCGCCACCAGCCTTCGTCAATAAACTGAATTTGTGTTATTAAGTCATCTGGGTCAAATGAGATCTCGGTATCATCCGCTGCTTGGTAGTCATACAGTGCCCGTGCGCAGACTCCTTTCTCTTCCTCCACTTCAATCTCATACACTGGTTCCTCCTGGGGTGTATCCTCATATATATTTTGGTTCTCAGTGGTATCCTCATATATATTTTGGTCCTCAGTGGCATCCTGGTATATATTCTCTTCTTCTTGCTGGGAGGCAGTACATTGCTCTTTCACATGGACAGTGGACTCTGGTGGATGAGAGACAGGGGGCACAGGAGATTCTGGGGGTGTCTGGTGAGCAGGATACACAGGGGGTGATGGGGGTTCCTGGACACGATGTACAGGGGACGGAGGAGGAGAAGACTCAGGCTGACAAGCCGACTTCTGCAAGAAGGGACTGCGCAGCCTCCCAGGCTGGGCACTCACTGGGCCAGACTCAGGTAATGAGCGCTCTTTCTGAAGGAACGTCTCACGTGGGTTAACAGAGCGCTGGGAGGCAGGAACCGTCTGCTGTTTCTCTGTTTCCCCTTGCTCTTTCCTCTGTGCATCTATCTCCTTTTCCCCTCTCCCGGACCCCCGGGCTCTCTTGGTCCCACCCCTCCCCTCCGCCTCTTCTCTCCCTTGGCCCCTCCTCTCCTCCCACCCAAAATCTTTTTTTCTGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGAGTAGCTCGACATAA