ORFeome > dcaf15 ORF1 – XORFeome v1.0

dcaf15 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dcaf15
Gene ID: 6255516
Gene Page ID: 969386
ORF Xenbase ID: 17271945

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130142
Original XGC clone length: 1803

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: A05

Sequences - 5สน (forward) EST

Accession: JZ838545
dbEST ID: 79656247
Trimmed Sequence: ATGGCGCCCAGCTCGAAATCGGAGCGGAACAGCGGGGCCGGGAGCGCCGGCGGAGGCCCTGGGGGGACCGGGGGGAAGCGGGCGGTGGGGCGGCGGCGGGAACACGTTCTCAAGCAGCTGGAGCGAGTCAAGATCAGTGGGCAGCTCTCACCTCGTCTTTTCCGGAAGCTGCCCCCCAGGGTCTGCGTGTCCCTCAAGAACATCGTAGATGAGGATTTTCTCTATGCAGGCCATATCTTCCTGGGATTTTCCAAGTGTGGCCGCTATGTCCTCTCCTACACCAGCAGCAGTGGGGATGACGACTTCTCCTTCTACATATATCACCTCTACTGGTGGGAGTTCAACGTCCACAGCAAGCTCAAGCTGGTCCGGCAGGTGCGGCTCTTCCAGGACGAGGAGATCTACAGTGACCTGTACCTGACTGTGTGTGAGTGGCCTAGCGACGCTTCCAAGGTCATCGTGTTTGGTTTCAACACCCGCTCGGCCAACGGGATGCTCATGAACATGATGATGATGAGCGATGAGAACCATCGTGACATCTACATCAGCACTGTGGCTGTGCCACCTCGGGGCCGTTGTGCTGCCTGCCAGGACGCCAGTCGTGCCCACCCAGGGGACCCCAGCGCACATTGCCTGCGGCATGGCTTCATGCTGCACACCAAATACCAAGTGGTGTACCCCTTCCCCCCCTTCCACCCCGCCTCCAACCTCAAAAGGAAAAGGGGGGGCGGCTCAAGCCAGCCTACTCCCTTGGGGGCCCGGCCCTGTCCCTTTTCCACTCACCCAGGGGCCCACCACTTTTTCGGCCCAAATCCTGTTTATAAACCACAACG
Full Trace Sequence: GCGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCCCAGCTCGAAATCGGAGCGGAACAGCGGGGCCGGGAGCGCCGGCGGAGGCCCTGGGGGGACCGGGGGGAAGCGGGCGGTGGGGCGGCGGCGGGAACACGTTCTCAAGCAGCTGGAGCGAGTCAAGATCAGTGGGCAGCTCTCACCTCGTCTTTTCCGGAAGCTGCCCCCCAGGGTCTGCGTGTCCCTCAAGAACATCGTAGATGAGGATTTTCTCTATGCAGGCCATATCTTCCTGGGATTTTCCAAGTGTGGCCGCTATGTCCTCTCCTACACCAGCAGCAGTGGGGATGACGACTTCTCCTTCTACATATATCACCTCTACTGGTGGGAGTTCAACGTCCACAGCAAGCTCAAGCTGGTCCGGCAGGTGCGGCTCTTCCAGGACGAGGAGATCTACAGTGACCTGTACCTGACTGTGTGTGAGTGGCCTAGCGACGCTTCCAAGGTCATCGTGTTTGGTTTCAACACCCGCTCGGCCAACGGGATGCTCATGAACATGATGATGATGAGCGATGAGAACCATCGTGACATCTACATCAGCACTGTGGCTGTGCCACCTCGGGGCCGTTGTGCTGCCTGCCAGGACGCCAGTCGTGCCCACCCAGGGGACCCCAGCGCACATTGCCTGCGGCATGGCTTCATGCTGCACACCAAATACCAAGTGGTGTACCCCTTCCCCCCCTTCCACCCCGCCTCCAACCTCAAAAGGAAAAGGGGGGGCGGCTCAAGCCAGCCTACTCCCTTGGGGGCCCGGCCCTGTCCCTTTTCCACTCACCCAGGGGCCCACCACTTTTTCGGCCCAAATCCTGTTTATAAACCACAACG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCCCAGCTCGAA

Sequences - 3สน (reverse) EST

Accession: JZ838544
dbEST ID: 79656246
Trimmed Sequence: CAGCACAATCCAAGTGTACCGCTCACTGTCTGCCAGAACCTTCAGTGAGCACCCTTTGTGCAGTGCCTCGTTTGTCATCCTGTTCACATAGCGGCCACTGCTCTCTGGCACCAGCCATTTCATGACCATGTCCACACAGCTCTTTCGGTAGGAGCTCCAGACACTGCCACTGGTCTGTCCTTTGACCTCAGTTAGATCACCCACGCTGACTGTCTCAAAGATGCCTGTGTTGAGGTCCCAGGCCACCTTGAGACTGGTGTGATAGGTCTTGGGTCGAAGCTGGCCCTCTTCAGTGGGAGCTGGAAAGGCTAAGAGCAGCAGGCCAATGTTGATCAGGACCTGGTTGGTTTCTGGGCAGACCTCCAAGATGACTATATCATAGTCACTGAAAGAGCAGAACTGGTGACCCCAAGTGGCATCATGGCGGATGACCTCGTTGATGACATACTCGAAGTCCAGGGTAAGCTGCTCCACTGTCAGGTACTGGCCCTGCATGTCTGTCCGCTCTCGCATGGGCCGTAAGTTGCGGCCACGGAGATCAGTCACCACAAAAGGCAGGGAGATCTTGTCATCCTCAAACTCATCCTCANGCTCTGTCCCTTCCCCAGACTGCAACACATAGTTGCACTTTGGTGTAATTGATGTAACCAGGCTCAGGGGGCAGTGGTCTCTGCAGCCAGGAGGGCTGTCCCCTGGGTACCACTTCCCCCACCTGGGGCTTGCGGGCTCTTAAAATGGGCCCGCAGCCGGCCTGCCTTGAAGGGCCCCAAA
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCACAATCCAAGTGTACCGCTCACTGTCTGCCAGAACCTTCAGTGAGCACCCTTTGTGCAGTGCCTCGTTTGTCATCCTGTTCACATAGCGGCCACTGCTCTCTGGCACCAGCCATTTCATGACCATGTCCACACAGCTCTTTCGGTAGGAGCTCCAGACACTGCCACTGGTCTGTCCTTTGACCTCAGTTAGATCACCCACGCTGACTGTCTCAAAGATGCCTGTGTTGAGGTCCCAGGCCACCTTGAGACTGGTGTGATAGGTCTTGGGTCGAAGCTGGCCCTCTTCAGTGGGAGCTGGAAAGGCTAAGAGCAGCAGGCCAATGTTGATCAGGACCTGGTTGGTTTCTGGGCAGACCTCCAAGATGACTATATCATAGTCACTGAAAGAGCAGAACTGGTGACCCCAAGTGGCATCATGGCGGATGACCTCGTTGATGACATACTCGAAGTCCAGGGTAAGCTGCTCCACTGTCAGGTACTGGCCCTGCATGTCTGTCCGCTCTCGCATGGGCCGTAAGTTGCGGCCACGGAGATCAGTCACCACAAAAGGCAGGGAGATCTTGTCATCCTCAAACTCATCCTCANGCTCTGTCCCTTCCCCAGACTGCAACACATAGTTGCACTTTGGTGTAATTGATGTAACCAGGCTCAGGGGGCAGTGGTCTCTGCAGCCAGGAGGGCTGTCCCCTGGGTACCACTTCCCCCACCTGGGGCTTGCGGGCTCTTAAAATGGGCCCGCAGCCGGCCTGCCTTGAAGGGCCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCACAATCCAAGTGTACC