ORFeome > dck.1 ORF1 – XORFeome v1.0

dck.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dck.1
Gene ID: 956572
Gene Page ID: 956566
ORF Xenbase ID: 17271993

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133781
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID: 1633
Ensembl gene IDs: ENSG00000156136
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102700,103050,180105,266120,278300,300322,300323,600462,603896,605258,608688

Library Location

Plate ID: GDExl11089
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ838474
dbEST ID: 79656176
Trimmed Sequence: ATGGCCACTCCACCGAAGCGGATTTGCATCGAATTGCCGCCATCCCCCTCAGGCAAGAAGCGCAAGGTCAAGAGGATCTCCATAGAGGGAAACATTGCTACAGGGAAATCTACCTTTGTCAATATTCTCACAAAGGCCAGTGAAGACTGGGAGGTTGTTCCTGAGCCCATAGCAAGATGGTGCAATATTCAGAGCTGCAAAGATGAATTTGAGGAGCTAACTAACTCTCAGAAAAGTGGAGGTAATCTACTCCAGATGATGTATGAAAAGCCAGAGCGCTGGTCTTTCACTTTCCAGTCCTATGCTTGTCTGAGCCGCATCAGGGCCCAGCTGAAGGCTCTGGGAGGGAAACTGAAAGAATCAGAAAATCCAGTGCTCTTTTTTGAACGTTCAGTCTATAGTGACAGGTATATCTTTGCATCCAATTTATATGAGACAGAGTGCATGAATGAGACTGAATGGACTGTTTACCAGGATTGGCATGACTGGATGAATTCTCAGTTCGGTGCAGATCTTGAACTAGATGGAATTATTTATCTCCGCGCCATCCCTGAGAAATGTTTAAACAGGATTCATTGTCGTGGGCGGGATGAAGAGCAGGGAATCCCCATGGAGTATTTGGAAAACTTCATTACAAGCATGAGAGCTGGCTTCATCACAGAACTATAAAAACGGATTTTGCGTACCTGCCGGAAATC
Full Trace Sequence: GGGGGCCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACTCCACCGAAGCGGATTTGCATCGAATTGCCGCCATCCCCCTCAGGCAAGAAGCGCAAGGTCAAGAGGATCTCCATAGAGGGAAACATTGCTACAGGGAAATCTACCTTTGTCAATATTCTCACAAAGGCCAGTGAAGACTGGGAGGTTGTTCCTGAGCCCATAGCAAGATGGTGCAATATTCAGAGCTGCAAAGATGAATTTGAGGAGCTAACTAACTCTCAGAAAAGTGGAGGTAATCTACTCCAGATGATGTATGAAAAGCCAGAGCGCTGGTCTTTCACTTTCCAGTCCTATGCTTGTCTGAGCCGCATCAGGGCCCAGCTGAAGGCTCTGGGAGGGAAACTGAAAGAATCAGAAAATCCAGTGCTCTTTTTTGAACGTTCAGTCTATAGTGACAGGTATATCTTTGCATCCAATTTATATGAGACAGAGTGCATGAATGAGACTGAATGGACTGTTTACCAGGATTGGCATGACTGGATGAATTCTCAGTTCGGTGCAGATCTTGAACTAGATGGAATTATTTATCTCCGCGCCATCCCTGAGAAATGTTTAAACAGGATTCATTGTCGTGGGCGGGATGAAGAGCAGGGAATCCCCATGGAGTATTTGGAAAACTTCATTACAAGCATGAGAGCTGGCTTCATCACAGAACTATAAAAACGGATTTTGCGTACCTGCCGGAAATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACTCCACCGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838473
dbEST ID: 79656175
Trimmed Sequence: TAAAGTGCTCAAAAATTCTTTAACCTTTTCAATTAGGCTCTCTTGCTTTGGTTTATTATCTTTGAAATCTTCATTTACATCTAAAGTCAGGATGGGGATTTCCTGCAGGTACGCAAAATCCGTTCTCATAGTTCTGTGATGAAGCCAGCTCTCATGCTTGTAATGAAGTTTTTCCAAATACTCCATGGGGATTCCCTGCTCTTCATCCCGCCCACGACAATGAATCCTGTTTAAACATTTCTCAGGGATGGCGCGGAGATAAATAATTCCATCTAGTTCAAGATCTGCACCGAACTGAGAATTCATCCAGTCATGCCAATCCTGGTAAACAGTCCATTCAGTCTCATTCATGCACTCTGTCTCATATAAATTGGATGCAAAGATATACCTGTCACTATAGACTGAACGTTCAAAAAAGAGCACTGGATTTTCTGATTCTTTCAGTTTCCCTCCCAGAGCCTTCAGCTGGGCCCGGATGCGGCTCAGACAAACATAGGACTGGAAAGTGAAAGACCAGCGCTCTGGCTTTGCCTACATCCGCGGGAATAGATAAACTCCACTTTTCTAAGAGTTAATTAGCTGCTCAAATTCATCTTTTCAGCTCTGAAATATACACCAACATGCCTATGGGGGGGGGGAGGGACGTCCGAAATTTTCACTTCCCCTTTGGGGGGAAATAAAAAGGAAAGAAAAACACTGGCCGGTTTCTCGGGCGG
Full Trace Sequence: GGGAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAAGTGCTCAAAAATTCTTTAACCTTTTCAATTAGGCTCTCTTGCTTTGGTTTATTATCTTTGAAATCTTCATTTACATCTAAAGTCAGGATGGGGATTTCCTGCAGGTACGCAAAATCCGTTCTCATAGTTCTGTGATGAAGCCAGCTCTCATGCTTGTAATGAAGTTTTTCCAAATACTCCATGGGGATTCCCTGCTCTTCATCCCGCCCACGACAATGAATCCTGTTTAAACATTTCTCAGGGATGGCGCGGAGATAAATAATTCCATCTAGTTCAAGATCTGCACCGAACTGAGAATTCATCCAGTCATGCCAATCCTGGTAAACAGTCCATTCAGTCTCATTCATGCACTCTGTCTCATATAAATTGGATGCAAAGATATACCTGTCACTATAGACTGAACGTTCAAAAAAGAGCACTGGATTTTCTGATTCTTTCAGTTTCCCTCCCAGAGCCTTCAGCTGGGCCCGGATGCGGCTCAGACAAACATAGGACTGGAAAGTGAAAGACCAGCGCTCTGGCTTTGCCTACATCCGCGGGAATAGATAAACTCCACTTTTCTAAGAGTTAATTAGCTGCTCAAATTCATCTTTTCAGCTCTGAAATATACACCAACATGCCTATGGGGGGGGGGAGGGACGTCCGAAATTTTCACTTCCCCTTTGGGGGGAAATAAAAAGGAAAGAAAAACACTGGCCGGTTTCTCGGGCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAAGTGCTCAAAAATTCTTTAAC