ORFeome > ddb1 ORF1 – XORFeome v1.0

ddb1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ddb1
Gene ID: 967911
Gene Page ID: 967907
ORF Xenbase ID: 17272119

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061946
Original XGC clone length: 3423

Human orthology & disease relationships

NCBI Entrez ID: 1642
Ensembl gene IDs: ENSG00000167986
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,601675

Library Location

Plate ID: GDExl11021
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AACAAAATTAATTTTTTTTTTTTTTGATGAACCGCTGGTTCATTCAATAAATAAGAGGCTTTTTTTTTACCTGCTTTTTAAAAAAATGGTCGGGGCGGGTATTCATTACTTTTGTGACTTTGATGCTTTTTGATACTTTACGGGCGCAGCCTTTTGAACCGGTTCCGACATACAGCGAGAAGCTCCACTGCGGAATCCGTTTTGACTGCCCTCGCGACGGACTGTGGAATCCTACGCGGCCTTCGACATCCCTGTGGCGGGGAACAGGTAGGAAAGCCACCGTATAGTTGTCGATATCCGTACCGGGGGGGGAAGAGAATTGCTTGTTCCGCGGAGGGCTGCCTCCAAAGCTTGTTGTATGTGGTTATGAAACTGCACTGGAGCTGCTTGATACTGTTAATACACACGAAGTCTGAAATAGAAACATCTCAAAATGCGCCTGTCCACAGGAGATACTTGATTTTTTTGTTTGCCACAGAAGTTAAATACGCGTCCGCGGCGCGGGCACGCTCTTGTCCCCCACCCGATCTATGCGACCGGAAACATCTCCAATCCGCGGGCCCCCCAAGAGAAAAGAAAGAGCTGTACTGGGAACGGTGCCTCTCTCAAGGGCGTCGCCCACCCCCTTTCTCATGCCTTGAATAACGGGACTCTACGGCAGAAATATCAGATGGGTTGCTGTTTGTATAGGGGTCACCGTGAACCGGTGGGGGGCCATTAAAATCAGGAGAGGGGTGACAATCAGTTTCCTTTTTGTGCCATGAACTCTCCCAAAGCCGAGGGGAGGGGGGCCATAAGCTTAGAAAGAGGAGATTCCTCTCCCCCCCTTAAAAGAAAAGAGAAAAAAAAGGCCGCGCGGGGGAGGGGGGGGCCTACGGAATTACACCCCGCGTGCTCCCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGTACAACTATGTGGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ830125
dbEST ID: 79647827
Trimmed Sequence: GTGAATCCTCGTCAGTTCTTCAACTACCTTTATCAAGTCATCCACCGTGGTCTCCCTTTTCATCCCACTGCCGTCGTCGATCTGTAGATTCGCAATGACCTCCTGCATCTTTGGCCGGCTAATGTCCAGGAAGCTCTCGATCAGATCCCCATCTATGAATCCTGTGGCTGGTTCGGTCTTCCTCTCTGTGTGGAATGACCTCCAAAATGAGTGTTCGATCTTGCCAACGCTTTTGATTACTTTGTTGAGTCTGTTCTGAACATCTAGAAGCAGATTGTACCAGCTCTCAGAAAGTGAAGTAACAAGACCAATCATTCCATTAACTGTGCCAAAGAGTACAGAGCCCTGAGTAGGCGGGGAGGTCTCACCCAGATTCTGCATTACCAGGGAGCCATGACAGAAGACATTAACAAATTCACCCAGATGAAAGAGACCGACTTCTTGTAAATGCTGCCGCTCCTCATCAGTAGTAGCAGCACTGTCTTTCTGACACACAAATAAATTGAAAGCATTCTCGGCTCCCAGGAAATTGTCGTCATCTAAAATCTCCACGGCGCTCATCCAGTTAGGATCTGAATCTCGTGCAATCTCCATCAAGTTTCCTTCCATCGGTTTATAAGCCAACAGCAGCACTGAGCGCATCAAGTCTCCCACCAGGATAAAATCACCCTTTGTTTTCAGATAGAGAGCATGAAAATTGGTGGTAGGGGGTGGCCTCCTGTTCCCAAATTTCCTTTCTACCAGTCCCACTCCATAAAGGCCAAACCCCGGGGGTT
Full Trace Sequence: ACGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAATCCTCGTCAGTTCTTCAACTACCTTTATCAAGTCATCCACCGTGGTCTCCCTTTTCATCCCACTGCCGTCGTCGATCTGTAGATTCGCAATGACCTCCTGCATCTTTGGCCGGCTAATGTCCAGGAAGCTCTCGATCAGATCCCCATCTATGAATCCTGTGGCTGGTTCGGTCTTCCTCTCTGTGTGGAATGACCTCCAAAATGAGTGTTCGATCTTGCCAACGCTTTTGATTACTTTGTTGAGTCTGTTCTGAACATCTAGAAGCAGATTGTACCAGCTCTCAGAAAGTGAAGTAACAAGACCAATCATTCCATTAACTGTGCCAAAGAGTACAGAGCCCTGAGTAGGCGGGGAGGTCTCACCCAGATTCTGCATTACCAGGGAGCCATGACAGAAGACATTAACAAATTCACCCAGATGAAAGAGACCGACTTCTTGTAAATGCTGCCGCTCCTCATCAGTAGTAGCAGCACTGTCTTTCTGACACACAAATAAATTGAAAGCATTCTCGGCTCCCAGGAAATTGTCGTCATCTAAAATCTCCACGGCGCTCATCCAGTTAGGATCTGAATCTCGTGCAATCTCCATCAAGTTTCCTTCCATCGGTTTATAAGCCAACAGCAGCACTGAGCGCATCAAGTCTCCCACCAGGATAAAATCACCCTTTGTTTTCAGATAGAGAGCATGAAAATTGGTGGTAGGGGGTGGCCTCCTGTTCCCAAATTTCCTTTCTACCAGTCCCACTCCATAAAGGCCAAACCCCGGGGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAATCCTCGTCAGTTCTT