ORFeome > ddit4 ORF1 – XORFeome v1.0

ddit4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ddit4
Gene ID: 944281
Gene Page ID: 944275
ORF Xenbase ID: 17272131

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054246
Original XGC clone length: 660

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ839570
dbEST ID: 79657272
Trimmed Sequence: ATGCCTGCAAGATGGGACGCCTTCTCTGCTCTCTCCGTGCCACCCCCAATCTTGGAGGAAGAGTCTCCATCCCAATTTTGGGGCGAAGACTGCGCAAATGTGGCGCAAAGGTGCTCCAGTTTGCCCAGTTCCGACTGTGAATCTCTCACCAGTAGCAACTCTTACTCTGAATGCGATCTAGATGCTTGGGATGAAATCTCTATACCAGACTCTGAGCTTCTGAATGATCCCGAAGGAGAGCAGCTGTGCCCCAGTCTTTTAAAGCTCATAAACCGGTGCCTGACCAAAGCCAGAATCAATTCCCTGAGGTGTTCAAGGCTTCTCATTCCTGATGAGCTTTTGTGTAATCTGGGTCAAGAACTGCTACACTTGGCATACAGTGAACCTTGTGGACTTAGGGGAGCACTTATTGACTTGTGTGTGGAGAATGGCAAGGACTGCCACAGTGTGGCCCAAATAACTGTTGATCAAGCGGTTGTACCAACGTTCCAACTTACTGTACTGCTGAGACTGGACTCCAGACTCTGGCCTAGAATACAGGGCCTCTTTAGCACCAAGCCAGTTCCTGGTTCTGGACAATCTCTGAAACTTAGCCCTGGATTCAAGGTTCTGAAAAAGAAACTGTACAGTTCTGAAGAACTCATCATAGAAGAATGCTT
Full Trace Sequence: GGACCCCAAATAATTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGCAAGATGGGACGCCTTCTCTGCTCTCTCCGTGCCACCCCCAATCTTGGAGGAAGAGTCTCCATCCCAATTTTGGGGCGAAGACTGCGCAAATGTGGCGCAAAGGTGCTCCAGTTTGCCCAGTTCCGACTGTGAATCTCTCACCAGTAGCAACTCTTACTCTGAATGCGATCTAGATGCTTGGGATGAAATCTCTATACCAGACTCTGAGCTTCTGAATGATCCCGAAGGAGAGCAGCTGTGCCCCAGTCTTTTAAAGCTCATAAACCGGTGCCTGACCAAAGCCAGAATCAATTCCCTGAGGTGTTCAAGGCTTCTCATTCCTGATGAGCTTTTGTGTAATCTGGGTCAAGAACTGCTACACTTGGCATACAGTGAACCTTGTGGACTTAGGGGAGCACTTATTGACTTGTGTGTGGAGAATGGCAAGGACTGCCACAGTGTGGCCCAAATAACTGTTGATCAAGCGGTTGTACCAACGTTCCAACTTACTGTACTGCTGAGACTGGACTCCAGACTCTGGCCTAGAATACAGGGCCTCTTTAGCACCAAGCCAGTTCCTGGTTCTGGACAATCTCTGAAACTTAGCCCTGGATTCAAGGTTCTGAAAAAGAAACTGTACAGTTCTGAAGAACTCATCATAGAAGAATGCTTGCCAACTTTCTTGTACAAAGGTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTTCAAAATAAAATCATTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGCAAGATGGGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839569
dbEST ID: 79657271
Trimmed Sequence: GCATTCTTCTATGATGAGTTCTTCAGAACTGTACAGTTTCTTTTTCAGAACCTTGAATCCAGGGCTAAGTTTCAGAGATTGTCCAGAACCAGGAACTGGCTTGGTGCTAAAGAGGCCCTGTATTCTAGGCCAGAGTCTGGAGTCCAGTCTCAGCAGTACAGTAAGTTGGAACGTTGGTACAACCGCTTGATCAACAGTTATTTGGGCCACACTGTGGCAGTCCTTGCCATTCTCCACACACAAGTCAATAAGTGCTCCCCTAAGTCCACAAGGTTCACTGTATGCCAAGTGTAGCAGTTCTTGACCCAGATTACACAAAAGCTCATCAGGAATGAGAAGCCTTGAACACCTCAGGGAATTGATTCTGGCTTTGGTCAGGCACCGGTTTATGAGCTTTAAAAGACTGGGGCACAGCTGCTCTCCTTCGGGATCATTCAGAAGCTCAGAGTCTGGTATAGAGATTTCATCCCAAGCATCTGGATCGCATTCAGAGTAAGAGTTGCTACTGGTGAGAGATTCACAGTCGGAACTGGGCAAACTGGAACACCTTTGCGCCACATTTGCGCAATCTTCACCCCAAAATTGGGATGGAAACTCTTTCCTCCAAAATTGGGGGTGCCACGGAGAGAGAAAAAAAGGCTCCCCATCTTGCAGGCATGGTGGCCAACTTTTTTGTACAAAGTTGGGCATATAAAGAAAGGCATGGCGTCA
Full Trace Sequence: AAAAGTCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCATTCTTCTATGATGAGTTCTTCAGAACTGTACAGTTTCTTTTTCAGAACCTTGAATCCAGGGCTAAGTTTCAGAGATTGTCCAGAACCAGGAACTGGCTTGGTGCTAAAGAGGCCCTGTATTCTAGGCCAGAGTCTGGAGTCCAGTCTCAGCAGTACAGTAAGTTGGAACGTTGGTACAACCGCTTGATCAACAGTTATTTGGGCCACACTGTGGCAGTCCTTGCCATTCTCCACACACAAGTCAATAAGTGCTCCCCTAAGTCCACAAGGTTCACTGTATGCCAAGTGTAGCAGTTCTTGACCCAGATTACACAAAAGCTCATCAGGAATGAGAAGCCTTGAACACCTCAGGGAATTGATTCTGGCTTTGGTCAGGCACCGGTTTATGAGCTTTAAAAGACTGGGGCACAGCTGCTCTCCTTCGGGATCATTCAGAAGCTCAGAGTCTGGTATAGAGATTTCATCCCAAGCATCTGGATCGCATTCAGAGTAAGAGTTGCTACTGGTGAGAGATTCACAGTCGGAACTGGGCAAACTGGAACACCTTTGCGCCACATTTGCGCAATCTTCACCCCAAAATTGGGATGGAAACTCTTTCCTCCAAAATTGGGGGTGCCACGGAGAGAGAAAAAAAGGCTCCCCATCTTGCAGGCATGGTGGCCAACTTTTTTGTACAAAGTTGGGCATATAAAGAAAGGCATGGCGTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATTCTTCTATGATGAGTTCTTC