ORFeome > ddx1 ORF1 – XORFeome v1.0

ddx1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ddx1
Gene ID: 969102
Gene Page ID: 969095
ORF Xenbase ID: 17272161

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129617
Original XGC clone length: 2223

Human orthology & disease relationships

NCBI Entrez ID: 1653
Ensembl gene IDs: ENSG00000079785
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 164300,300590

Library Location

Plate ID: GDExl11091
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCTTCTCAGAAATGGGGGTGATGCCCGAGATTGCCCAGGCTGTGGAGGAAATGGATTGGCTTCTTCCTACAGATATCCAAGCAGAGTCCTCACACGTCCTTCCTGCAGCTGGGATACCTTTCTAATCAGCTTTTCCGAAGCTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGAGAATCGTATATAAGGGTCGTAGCTGTTTCCTGGAAACTCGTGGGCCGTGTCTAATAGGCACTGAGGACACTAAAAAATGAGCCTAGTAAAAAGAGGCGTGAAGAAAAAAAAAAGACGAAGACGAGAAACAAAGCCTAGGGGTGACTGGGGCTGGGAGGGGGGATGGTGGCGAGAAGAAGTGGAAGAAGGGAAGGGTGGGCGGGAGAAAGGTAGAAAAAAGCTCGAATTGAGGACTTAGCAGATGGAGAGAAAAATGTTGAGTGGACCGGTCGGGATAAGAAGAAAAAAAGAAAGAGGAGTTAAACAGGGTGAGGTGATGTGTAGGATGAGATCGGGGATCTGTAGGATGCTGAAGAGATTGAGTTGTTGGTGGGGAGGGAGGGGTGGGTGATTGTATCGTGAGAGGTACTAGAGGGAGGAAGGGGGGGACGGGAGGAAGGGGATGAAAGAGGGATGAGAAAGTGGAGTGGTGTGGACGAGAGATGTGATAAAATAGAGATTATAAAGAAAAATGATAAGTACGAAGAAAGAGAAAAGAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCTTCTCAGAAA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGCTTCGGAAAAGCTGATTATAAGGGTATCCCAGGTGCAGGAAGGACGTCTGATGACGCTGCTTGGATATCAGTAGGAGCAATCCCATCCTTTTCCTCCTCTTCCTGTTTAATCGCGGGCATCACCCCCTGTTATGACAAGGCTGCTGAGGTCCCCAGTTTTTTGTCTTCAGGTTGCTTTATAAAAAAGCATTGCTCATCGATTTGTTGCAACAAACAGGTCACTATCGTTCAAAATATAATCATTATTTGCAGCCCAATTCTAACACTCCCCGTCCTTTTAGAAAAAAAACAGAACAAATTTAAAAAGTTAGGGCCGATCTCCCACCGCCCAGACAAAAAAAAAAACCAACCCCCAACTCCGGGCTTCCGTTGGTTCCTACTCTGGGGGCAATGTATATCACCAGATGGACGAGTCAAAGCGCCCGTTCTTTTNAGGGGAAAAAAAAGCAATGGCAGAGGGAAAAANGAGGGGGAAANGACGTGGGNNANGNNGAAAAAGAAAAAAAAGAAAGAAAACTAAAAATAAAGTTGTAAAAGGACTCNTCCCGAANTGGACAGAGAAAAAAAGAGAACCGAGAGTCGCNTTCGCGCACAAGGGGTNNCTTTGTGTGTGTTTTNNGGAGGGGGAGNNNNGNNNAGTAGAGNNNNNGAAAANNNGAGGGGGAAANGNGNNGANGGGGTGTNGGGTTGTGGAANNANNNGAAGNNNNGAGNANAGATGANNGNNGTNGGGNGTGTNNTTNNTGGGGNGNTGGNNNNTNNNNNGNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCTTCGGAAAAGCTG