ORFeome > ddx10 ORF1 – XORFeome v1.0

ddx10 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ddx10
Gene ID: 985920
Gene Page ID: 985913
ORF Xenbase ID: 17272167

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123291
Original XGC clone length: 1992

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ837515
dbEST ID: 79655217
Trimmed Sequence: ATGGCGGAACCGAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTACTGCCCTCCGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAGGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAAGAGATGTTTTTTGGGATCGAGGATGGGCAGCTTCACACTGCCTGGTCTGGGCCACAAACCTTGCTCCTGAACCTTTCCCTTGCATTTTTAATTATCTCCTAAAGGGG
Full Trace Sequence: GGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACCGAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTACTGCCCTCCGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAGGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAAGAGATGTTTTTTGGGATCGAGGATGGGCAGCTTCACACTGCCTGGTCTGGGCCACAAACCTTGCTCCTGAACCTTTCCCTTGCATTTTTAATTATCTCCTAAAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACCGAGCCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837514
dbEST ID: 79655216
Trimmed Sequence: TTTATAAAGTGCCAACACACTGTGCAAATACATGGCAATGTGTATAGGAACTGGGCTGGCGTACATTAGAGATATTAAAATGCAAGGAAGGTCAGAGCAAGGTTGTGTGCCAGACAGCAGTGTGAAGCTGCCATCCTCGATGCCAAAAACATCTCTCCGTTTCACTGTGAGGATGTCAACATCTCGACAGTCATCGTCGTCCTCATCCTCATTCATAAACTGCAAACTGGTTTGCTTTATGCTGTCTGAGAGCTCTTGCTCATCATCCTCTTCTGGATCACTCGCTTCCTCTTAAGAATTTACTTTTTCGGTATCAGGCTCTGCTTTGGTCAGCCTCTTGCTTCCCACCCAAGCTGTGACGGAGAGGGTTCTATTTGTTAATCACATTTATTGCAGGGGGGGTGTTTTCTTTGAGAGGAAAAGAAAAGCGAAAAAGAGAGAGAAGAAACAAAAACAGCGGGTGCAGAGAAAAGGAAGAAGGAAGGAGGAAATNGGGAGAAGGGTAAAGAGTGTCAANAAACATAATATCTCCATGGTCGGAGAGATTAAGCCCGGGAGGGAAGAAAAAAAAAAAAACAAAAAAAAAGAAAGAAAAAAAACTGGGGGAGGGGGGGAAAGAAGGGAACAGAGAACGACAAAGGGAGAGGGAGGTCGACCGGGGGGGGGGAAAAAAAAGAAGGGGGGGGGGGAGTGTGGTAAGAAGGGGGTGGGGGGGGCTCATTTGATTNTAAAGGCGGGGGGGAGAAAACGAAGAGGGGGGGGGGGCTCGCGC
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTATAAAGTGCCAACACACTGTGCAAATACATGGCAATGTGTATAGGAACTGGGCTGGCGTACATTAGAGATATTAAAATGCAAGGAAGGTCAGAGCAAGGTTGTGTGCCAGACAGCAGTGTGAAGCTGCCATCCTCGATGCCAAAAACATCTCTCCGTTTCACTGTGAGGATGTCAACATCTCGACAGTCATCGTCGTCCTCATCCTCATTCATAAACTGCAAACTGGTTTGCTTTATGCTGTCTGAGAGCTCTTGCTCATCATCCTCTTCTGGATCACTCGCTTCCTCTTAAGAATTTACTTTTTCGGTATCAGGCTCTGCTTTGGTCAGCCTCTTGCTTCCCACCCAAGCTGTGACGGAGAGGGTTCTATTTGTTAATCACATTTATTGCAGGGGGGGTGTTTTCTTTGAGAGGAAAAGAAAAGCGAAAAAGAGAGAGAAGAAACAAAAACAGCGGGTGCAGAGAAAAGGAAGAAGGAAGGAGGAAATNGGGAGAAGGGTAAAGAGTGTCAANAAACATAATATCTCCATGGTCGGAGAGATTAAGCCCGGGAGGGAAGAAAAAAAAAAAAACAAAAAAAAAGAAAGAAAAAAAACTGGGGGAGGGGGGGAAAGAAGGGAACAGAGAACGACAAAGGGAGAGGGAGGTCGACCGGGGGGGGGGAAAAAAAAGAAGGGGGGGGGGGAGTGTGGTAAGAAGGGGGTGGGGGGGGCTCATTTGATTNTAAAGGCGGGGGGGAGAAAACGAAGAGGGGGGGGGGGCTCGCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTATAAAGTGCCAACACACTGTG