ORFeome > ddx19b ORF1 – XORFeome v1.0

ddx19b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ddx19b
Gene ID: 5903234
Gene Page ID: 5902963
ORF Xenbase ID: 17272179

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046696
Original XGC clone length: 1464

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ824107
dbEST ID: 79641809
Trimmed Sequence: ATGGCGACTGATTCCTGGGCCCTGGCGGTGGATGAACAGGAGGCGGCGGCTGAGACGCTTGGCAAGTTAAACCTGAAAGAAGAAAAAGTGGAGAAGCTAAAGCCAGAGAGCAATGGCACAGATGATGCGGAGAGTGCAGAGCAGACTGACGGCAAGAATGTAGAGAAGAAAGACGATGATGATAAAGAGGACAAAGCCGCCCAGTCGCTGCTCAACAAGCTTATTCGGAATAATCTGGTCGGCAACACAAACCAAGTGGAGGTTCTGCAACGGGATCCGAATTCTCCCCTGTACTCTGTCAAGTCATTTGAGGAGCTGAGACTGAAGCCAGAACTCCTCCAAGGTGTCTACGCCATGGGATTTAACAGGCCCTCCAAGATCCAAGAGAATGCTTTGCCCATGATGCTGGCTGAGCCGCCTCAGAACCTCATTGCCCAGTCTCAGTCGGGAACAGGTAAAACTGCTGCCTTCGTTCTTGCCATGCTGAGCCGAGTGGATCCTGCAAACAGATATCCCCAGTGCTTGTGCCTCTCTCCAACCTACGAGCTGGCTCTACAGACCGGGAAGGTCATTGAACAAATGGGGCAGTTTTCGAACATCANATTGGCCTACGCTGTACGAGGAAAGAAACTGGAACGTGGACATAAGATTCCGGAGCATATTGTTATTGGCACACCANGAACTGTGCTCGACTGGTGCTCCAAACTGAGGTTTATTGATCCCAGGAANGATTAAGGTGTTTGTACTTGATGAAGCCGACGTGATGATCGCTACTCAGGGACCCCAGGAACAAAATATCCCGCATCCAGAAGAATGCCTGCCCCCGGGACGGCCCCAAAG
Full Trace Sequence: TAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGACTGATTCCTGGGCCCTGGCGGTGGATGAACAGGAGGCGGCGGCTGAGACGCTTGGCAAGTTAAACCTGAAAGAAGAAAAAGTGGAGAAGCTAAAGCCAGAGAGCAATGGCACAGATGATGCGGAGAGTGCAGAGCAGACTGACGGCAAGAATGTAGAGAAGAAAGACGATGATGATAAAGAGGACAAAGCCGCCCAGTCGCTGCTCAACAAGCTTATTCGGAATAATCTGGTCGGCAACACAAACCAAGTGGAGGTTCTGCAACGGGATCCGAATTCTCCCCTGTACTCTGTCAAGTCATTTGAGGAGCTGAGACTGAAGCCAGAACTCCTCCAAGGTGTCTACGCCATGGGATTTAACAGGCCCTCCAAGATCCAAGAGAATGCTTTGCCCATGATGCTGGCTGAGCCGCCTCAGAACCTCATTGCCCAGTCTCAGTCGGGAACAGGTAAAACTGCTGCCTTCGTTCTTGCCATGCTGAGCCGAGTGGATCCTGCAAACAGATATCCCCAGTGCTTGTGCCTCTCTCCAACCTACGAGCTGGCTCTACAGACCGGGAAGGTCATTGAACAAATGGGGCAGTTTTCGAACATCANATTGGCCTACGCTGTACGAGGAAAGAAACTGGAACGTGGACATAAGATTCCGGAGCATATTGTTATTGGCACACCANGAACTGTGCTCGACTGGTGCTCCAAACTGAGGTTTATTGATCCCAGGAANGATTAAGGTGTTTGTACTTGATGAAGCCGACGTGATGATCGCTACTCAGGGACCCCAGGAACAAAATATCCCGCATCCAGAAGAATGCCTGCCCCCGGGACGGCCCCAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACTGATTCCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829415
dbEST ID: 79647117
Trimmed Sequence: CTTACTGATTTTTTCAATTTCATCAATGTCATCAGCGTCGAGGTGTTCAATCTTTTTACTGAAGTGCTGCTGGATCCGTTGGAGAATCTCCATGTTGTGTTTACTGTCAACCATATTGATGGCCAGCCCTCGCTTGCCGAAGCGCCCCGTGCGACCGATTCTATGAAGGTAGGTCTCGTTATCCGGGTTCCCGTCCTTGTCCACGGGAAGGTCAAAGTTAATCACAACAGACACTTGTTCCACGTCGATACCTCTGGCGCACACGTTGGTTGTAACCAACACTTTCTCTTTACCCTCTCGGAATCGATCAATGACGGCTGCCCTCTGCTCCACCATCATCTCTCCGCTCAGCATGGCCACCTGGTGGCCTTCTTTGTACAGCTCACCGGCCAACCAGGATGCAGTCTTGCGGGTATGGCAGAAGATCATGGCCTGTGCGATGGTGATGGAGCCGTAGATGTTGCACAGAGCTCGGAACTTATCGTCGCGGTTATTACACATGACGTAGTACTGTTTGATGGTGTCCAGGGTCTCCTCCTCCCTTTTCAGTTTGATGATGTTGGGGTTCCGGCACCACTTTCTGTGCAAACCTCCACACGGATTCTTTCAACGTGGGCGAAGAAAAGCAGCATCTGGCAGTCCCGGGGGCACCATCCTTCTGGATGCGGGATACTTCTGAACCTGGTGGTCCCTGAAATAAGGAATCAATCACGGTCCGGCCTTCCTTCCAAGTAACAAAAACCCCTTTAAATCCTTCTTTTGGGGAAACA
Full Trace Sequence: CTGGCGAGAAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTACTGATTTTTTCAATTTCATCAATGTCATCAGCGTCGAGGTGTTCAATCTTTTTACTGAAGTGCTGCTGGATCCGTTGGAGAATCTCCATGTTGTGTTTACTGTCAACCATATTGATGGCCAGCCCTCGCTTGCCGAAGCGCCCCGTGCGACCGATTCTATGAAGGTAGGTCTCGTTATCCGGGTTCCCGTCCTTGTCCACGGGAAGGTCAAAGTTAATCACAACAGACACTTGTTCCACGTCGATACCTCTGGCGCACACGTTGGTTGTAACCAACACTTTCTCTTTACCCTCTCGGAATCGATCAATGACGGCTGCCCTCTGCTCCACCATCATCTCTCCGCTCAGCATGGCCACCTGGTGGCCTTCTTTGTACAGCTCACCGGCCAACCAGGATGCAGTCTTGCGGGTATGGCAGAAGATCATGGCCTGTGCGATGGTGATGGAGCCGTAGATGTTGCACAGAGCTCGGAACTTATCGTCGCGGTTATTACACATGACGTAGTACTGTTTGATGGTGTCCAGGGTCTCCTCCTCCCTTTTCAGTTTGATGATGTTGGGGTTCCGGCACCACTTTCTGTGCAAACCTCCACACGGATTCTTTCAACGTGGGCGAAGAAAAGCAGCATCTGGCAGTCCCGGGGGCACCATCCTTCTGGATGCGGGATACTTCTGAACCTGGTGGTCCCTGAAATAAGGAATCAATCACGGTCCGGCCTTCCTTCCAAGTAACAAAAACCCCTTTAAATCCTTCTTTTGGGGAAACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTACTGATTTTTTCAATTTCATC