ORFeome > ddx52 ORF1 – XORFeome v1.0

ddx52 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ddx52
Gene ID: 993523
Gene Page ID: 993517
ORF Xenbase ID: 17272239

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124840
Original XGC clone length: 1845

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ838827
dbEST ID: 79656529
Trimmed Sequence: ATGGACGCGTTCGATCTCTCCAGTGTTGAATGGTTGATTGTTGATGAATCAGACAAATTATTTGAAGATGGAAAGACAGGATTCCGAGATCAGCTGGCTTCTATATTTGTGGCATGCACATCCCATCTGCTTAAAAGAGCCATGTTCAGTGCAACATTTGCTTTTGATGTAGAACAGTGGTGCAAACTACACCTTGACAATGTGGTTTCCGTTTCTGTTGGTGCAAGGAACTCTGCAGTGGAGACTGTAGAACAGTCGCTGTTATTTGTCGGATCAGAAACAGGCAAGCTTTTGGCTATGAGGGACCTCGTTAAAAAGGGCTTCGCTCCACCAGTACTGGTGTTTGTACAGTCTATCGAACGGGCAAAGGAGCTGTTTCATGAACTCATTTATGAAGGAATCAATGTGGATGTTATACACGCAGAAAGAACGCAGCAGCAGAGAGACAACGTTATTCAGAGTTTCAGAGAAGGGAAAATCTGGGTTCTTATTTGCACAGCCTTGCTAGCAAGAGGAATTGATTTTAAAGGTGTTAATATGGTCATCAACTATGATTTCCCTGCTGGCGCCGTGGGATACATACACCAAAAAGGGCAAACTGGTCAAGCCGGCCACAAGGGTAAAGCAGTCAGTTTTCTTTATGAAGATTATAACCCTATGCTTTCCCTTGTTACCGGTGGTAATTTAAAAACCAGGAAGTCCAATTTCCGGAATATTTTAAAAATTTTTCCCAAATAAAAAAAAAAAAACAAAAAAAAAAGAATATTAAAGCCCCCTCTTTAGAGGGAAATTAAAAATCGGCAACAACTCCCAAAAATCTATTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGCGTTCGATCTCTCCAGTGTTGAATGGTTGATTGTTGATGAATCAGACAAATTATTTGAAGATGGAAAGACAGGATTCCGAGATCAGCTGGCTTCTATATTTGTGGCATGCACATCCCATCTGCTTAAAAGAGCCATGTTCAGTGCAACATTTGCTTTTGATGTAGAACAGTGGTGCAAACTACACCTTGACAATGTGGTTTCCGTTTCTGTTGGTGCAAGGAACTCTGCAGTGGAGACTGTAGAACAGTCGCTGTTATTTGTCGGATCAGAAACAGGCAAGCTTTTGGCTATGAGGGACCTCGTTAAAAAGGGCTTCGCTCCACCAGTACTGGTGTTTGTACAGTCTATCGAACGGGCAAAGGAGCTGTTTCATGAACTCATTTATGAAGGAATCAATGTGGATGTTATACACGCAGAAAGAACGCAGCAGCAGAGAGACAACGTTATTCAGAGTTTCAGAGAAGGGAAAATCTGGGTTCTTATTTGCACAGCCTTGCTAGCAAGAGGAATTGATTTTAAAGGTGTTAATATGGTCATCAACTATGATTTCCCTGCTGGCGCCGTGGGATACATACACCAAAAAGGGCAAACTGGTCAAGCCGGCCACAAGGGTAAAGCAGTCAGTTTTCTTTATGAAGATTATAACCCTATGCTTTCCCTTGTTACCGGTGGTAATTTAAAAACCAGGAAGTCCAATTTCCGGAATATTTTAAAAATTTTTCCCAAATAAAAAAAAAAAAACAAAAAAAAAAGAATATTAAAGCCCCCTCTTTAGAGGGAAATTAAAAATCGGCAACAACTCCCAAAAATCTATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGCGTTCGATCTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838826
dbEST ID: 79656528
Trimmed Sequence: TGTTTCATGTGCTTCTGGCTGCTTGTTGTCTTCTTGAGCACTAACTTTTTCCTTTTCTTTCAGATTTCTTTTAATGATGTTCCTTTTTCTTTTTGCTTTTTCCAGAATGTATTTTGGAGTTGTGCGGATCTGATCTCTCTTTAGAGGGCGCTTGATCATCCTCTTTTTCTGTTTTTTTTGTAGTTTGCGAAAACTTTTAATATAATCCGGAATTGGACATCCTGCTTTCTGAATCACACTCGCTACACTGCGAAGCATAGGCTTATCATCCTCAGTAAAGAAACTGACTGCTTTACCCTTGTGGCCGGCTCGACCAGTTCGCCCTATTCGGTGTATGTACTCCACGGCGCCAGCAGGGAAATCATAGTTGATGACCATATTAACACCTTTAAAATCAATTCCTCTTGCTAGCAAGGCTGTGCAAATAAGAACCCACATTTTCCCTTCTCTGAAACTCTGAATAACGTTGTCTCTCTGCTGCTGCGTTCTTTCTGCGTGTATAACATCCACATTGATTCCTTCATAAATGAGTTCATGAAACAACCTCTTTGCCCGTTCGATACACTGTACCAACACCAATACTGGTTGAACGAAACCCCTTTTTAAAAAGGTCCCTCAAATCCAAAACTTTGGCGGTTTCTGAACCGCACAAATAAAACCGATGTTTTAAAGTCCTCCCTTGCAAAGTTCCTTGGCACCAACAAAAAACAGAAAAACAACATTTGTCAAGGGGTGAAGTTTGTCACCAATGTTTTCACCTTCCAAAAAGCAAAAAT
Full Trace Sequence: GGAAATAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTTTCATGTGCTTCTGGCTGCTTGTTGTCTTCTTGAGCACTAACTTTTTCCTTTTCTTTCAGATTTCTTTTAATGATGTTCCTTTTTCTTTTTGCTTTTTCCAGAATGTATTTTGGAGTTGTGCGGATCTGATCTCTCTTTAGAGGGCGCTTGATCATCCTCTTTTTCTGTTTTTTTTGTAGTTTGCGAAAACTTTTAATATAATCCGGAATTGGACATCCTGCTTTCTGAATCACACTCGCTACACTGCGAAGCATAGGCTTATCATCCTCAGTAAAGAAACTGACTGCTTTACCCTTGTGGCCGGCTCGACCAGTTCGCCCTATTCGGTGTATGTACTCCACGGCGCCAGCAGGGAAATCATAGTTGATGACCATATTAACACCTTTAAAATCAATTCCTCTTGCTAGCAAGGCTGTGCAAATAAGAACCCACATTTTCCCTTCTCTGAAACTCTGAATAACGTTGTCTCTCTGCTGCTGCGTTCTTTCTGCGTGTATAACATCCACATTGATTCCTTCATAAATGAGTTCATGAAACAACCTCTTTGCCCGTTCGATACACTGTACCAACACCAATACTGGTTGAACGAAACCCCTTTTTAAAAAGGTCCCTCAAATCCAAAACTTTGGCGGTTTCTGAACCGCACAAATAAAACCGATGTTTTAAAGTCCTCCCTTGCAAAGTTCCTTGGCACCAACAAAAAACAGAAAAACAACATTTGTCAAGGGGTGAAGTTTGTCACCAATGTTTTCACCTTCCAAAAAGCAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTTCATGTGCTTCTGGCT