ORFeome > def8 ORF1 – XORFeome v1.0

def8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: def8
Gene ID: 967887
Gene Page ID: 967881
ORF Xenbase ID: 17272287

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056097
Original XGC clone length: 1332

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ824724
dbEST ID: 79642426
Trimmed Sequence: ATGGAATACGATGATAAACTGGTCCGCTTCCGCCAGGGTCATCTCAATCCCTTTGATAAAAAAGGGGGAGCAGAGCGCCACCCCGCAGACTCTGAAACGCAGCCTTGCAAAGATTCCTCTACAAGTTCTCCACTCTCTGTACCAGAATACAACTACCCAGACAGAGTGATGGACCTTGGAGTATCAGAGGATCATTTCTCCCGGCCTGTGGGCCTTTTCCTAGCATCTGATGTCCAGCAGCTGAGACAGGCAATCGAGGAGTGTAAGCAGGAGATCCTAGAGCTGCCCGAGAACTCTGATAGGCAGAAGGATGCAGTTGTTAGACTCATCCACCTACGGCTCAAGCTGCAAGAACTGAATGACCCCCTTGAGGATGAACCAAATCTGCGTGTTTTGTTGGAGCATCGATTCTACAAGGAAAAGAGCAAAAGTGTGAAACATCTTTGTGACAAGTGCAGCACATTTATCTGGGGCCTGATCCAAACTTGGTACACCTGCACTGGTTGTAGCTATAGCTGTCACAGCAAATGTCTAAACTTAATCACCAAACCCTGTGTGAGATCAAAAGTCAGTCATCAGGCAGAGTATGAGTTGTCTATTTGTCCAGAGGCTGGGTTGGACAGTCAAGACTACCGTTGTGCTGAATGCCGAAACTCCATTCTTTTAAAAGCTGTTCCAAGTGAAGCTCGGGCATGTGATAACACTGGGCAGTATTAAAGGCCTCATTTTCATTGGAAGGAACCTTCCGGTATCCCCGGCCCGGGCCATCCAAACGGGGACTTTAAACCCCCCAGGGGCCCTGCATTAAAAAAGGAAAAATTGGGCGCTGAGAGGGGGG
Full Trace Sequence: AATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAATACGATGATAAACTGGTCCGCTTCCGCCAGGGTCATCTCAATCCCTTTGATAAAAAAGGGGGAGCAGAGCGCCACCCCGCAGACTCTGAAACGCAGCCTTGCAAAGATTCCTCTACAAGTTCTCCACTCTCTGTACCAGAATACAACTACCCAGACAGAGTGATGGACCTTGGAGTATCAGAGGATCATTTCTCCCGGCCTGTGGGCCTTTTCCTAGCATCTGATGTCCAGCAGCTGAGACAGGCAATCGAGGAGTGTAAGCAGGAGATCCTAGAGCTGCCCGAGAACTCTGATAGGCAGAAGGATGCAGTTGTTAGACTCATCCACCTACGGCTCAAGCTGCAAGAACTGAATGACCCCCTTGAGGATGAACCAAATCTGCGTGTTTTGTTGGAGCATCGATTCTACAAGGAAAAGAGCAAAAGTGTGAAACATCTTTGTGACAAGTGCAGCACATTTATCTGGGGCCTGATCCAAACTTGGTACACCTGCACTGGTTGTAGCTATAGCTGTCACAGCAAATGTCTAAACTTAATCACCAAACCCTGTGTGAGATCAAAAGTCAGTCATCAGGCAGAGTATGAGTTGTCTATTTGTCCAGAGGCTGGGTTGGACAGTCAAGACTACCGTTGTGCTGAATGCCGAAACTCCATTCTTTTAAAAGCTGTTCCAAGTGAAGCTCGGGCATGTGATAACACTGGGCAGTATTAAAGGCCTCATTTTCATTGGAAGGAACCTTCCGGTATCCCCGGCCCGGGCCATCCAAACGGGGACTTTAAACCCCCCAGGGGCCCTGCATTAAAAAAGGAAAAATTGGGCGCTGAGAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAATACGATGATAAACTGGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ830076
dbEST ID: 79647778
Trimmed Sequence: TGGCTCCGCTCCAGGATTCTGCACCTGTTTCCTTAGGTTGAGTCTCATGCACCGTGGACAACTGGTGGAGTTTTCATAATAACAGTCCCTATGGAACACAGCAGCGCAGTCTTGGCACACAGATGTATGACTGTCAAATGGGAAGAGGATGTCTCCTTCCTTGCACAACTCACACATGAAACCCTTGGCCTGACATCGCTCACAGTCCAGCTTTATGTGTTTGGCAAAGGTGGTATGAATTTCTGTAAGAGAACAACCCAAGCGCCCACTGCTGATGTCTAGCAAGTCTTGTAGCGAGTACATATCATCATTTTCCACAAAGTGCTGGCGATCCTGCAGCTGGAGAAGAAGCCTATCTTCCATGGCTTCCTTGCATGTGATGAAATATGGCTTCATGAGAAGAATGTCCTGTCGCAGCTTCCGGATTTCTACCAGCTCCTCCACGTAGTTAAAAAGCAATGGATTAATCTCGCGTAACTTTAGCACAGGACGGCCCAGCATCAGAGCCAGATATCGCATACTATATCGAGACACCTTGCAGGGTTCAAAGTCCCAGTTGTGAATGGCCCGCGCAGGGATGACAGCAAGGTCATTCCCATGACAACTGATGCAGTAATACTGCCCAGTGTAATCACATTGCCCAGCTTCACTCGGAACAGCTCTAAAAAGAAATGGGGAGTTCGGCATTCAAGCACCAACGGGTAGTCTTGAACTTGTCCCAACCCCAGCCTCCCGGGAACAAATTAAAACAAACTCCAAAACCTCT
Full Trace Sequence: CGGGGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGCTCCGCTCCAGGATTCTGCACCTGTTTCCTTAGGTTGAGTCTCATGCACCGTGGACAACTGGTGGAGTTTTCATAATAACAGTCCCTATGGAACACAGCAGCGCAGTCTTGGCACACAGATGTATGACTGTCAAATGGGAAGAGGATGTCTCCTTCCTTGCACAACTCACACATGAAACCCTTGGCCTGACATCGCTCACAGTCCAGCTTTATGTGTTTGGCAAAGGTGGTATGAATTTCTGTAAGAGAACAACCCAAGCGCCCACTGCTGATGTCTAGCAAGTCTTGTAGCGAGTACATATCATCATTTTCCACAAAGTGCTGGCGATCCTGCAGCTGGAGAAGAAGCCTATCTTCCATGGCTTCCTTGCATGTGATGAAATATGGCTTCATGAGAAGAATGTCCTGTCGCAGCTTCCGGATTTCTACCAGCTCCTCCACGTAGTTAAAAAGCAATGGATTAATCTCGCGTAACTTTAGCACAGGACGGCCCAGCATCAGAGCCAGATATCGCATACTATATCGAGACACCTTGCAGGGTTCAAAGTCCCAGTTGTGAATGGCCCGCGCAGGGATGACAGCAAGGTCATTCCCATGACAACTGATGCAGTAATACTGCCCAGTGTAATCACATTGCCCAGCTTCACTCGGAACAGCTCTAAAAAGAAATGGGGAGTTCGGCATTCAAGCACCAACGGGTAGTCTTGAACTTGTCCCAACCCCAGCCTCCCGGGAACAAATTAAAACAAACTCCAAAACCTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGCTCCGCTCCAGGATT