ORFeome > degs3 ORF1 – XORFeome v1.0

degs3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: degs3
Gene ID: 6253421
Gene Page ID: 5801014
ORF Xenbase ID: 17272299

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054207
Original XGC clone length: 969

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ839363
dbEST ID: 79657065
Trimmed Sequence: ATGGGTAACATGGTTGTAAGGAATAACTTTGAATGGGTCTACACAGACCAGCCTCACTCAGATAGGAGGAAAGAAATACTAGCAAAATATCCTCAGATCAAGAATTTAATGGGACCCGACCCACACTTCAAGTGGATTGTCACTTTCATGGTTATGGTCCAGATACTGTCATGTTTTATTGTCCGTGATCTACCTTGGAAGTGGCTACTTTTCTGTTCTTATGCATTTGGGGGTGTAATAAACCACTCCCTTACCCTGGCAATCCATGACATCTCGCACAATGTAGCTTTTGGAAACAAATCAGCAAGGTGGAACCGCTTCTTTGGCATGTTTGCTAACTTACCTATTGGTGTGCCCTATTCCACATCCTTTAAAAAGTACCATATTGACCATCACCGTTATTTGGGTGGGGATGGCTTGGATGTGGATATCCCAACAGACTTTGAGGGACGTTTTTTCTGTACCCCCATTCGCAAGGTCCTTTGGATAGTAATACAACCTCTGTTGTATGTTCTGCGTCCACTTTATGTCAACCCCAAACCCAAAACTCATCTGGAGATCATAAATGCTCTAGTTCAATTTTCCTTTTACCTAGTAATATATTATCTGTGGGGACTTAGGCCTGTGGCATACTGGAATGGCTGATCATGGCTCTCCCTGGGGTTTCGCCCGATATCAAGGCATTTTATTGCTAAATACTACGTGTTTTTTAAAAGTTATGAAAAGGGGGGCCAAATAATGAACCAACCCAAAATTGGTTACCTTTCCAATTGTTTTGCAATTCGCATAGGGAAAAAATCAAGAAAAATTTCAAA
Full Trace Sequence: GCTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTAACATGGTTGTAAGGAATAACTTTGAATGGGTCTACACAGACCAGCCTCACTCAGATAGGAGGAAAGAAATACTAGCAAAATATCCTCAGATCAAGAATTTAATGGGACCCGACCCACACTTCAAGTGGATTGTCACTTTCATGGTTATGGTCCAGATACTGTCATGTTTTATTGTCCGTGATCTACCTTGGAAGTGGCTACTTTTCTGTTCTTATGCATTTGGGGGTGTAATAAACCACTCCCTTACCCTGGCAATCCATGACATCTCGCACAATGTAGCTTTTGGAAACAAATCAGCAAGGTGGAACCGCTTCTTTGGCATGTTTGCTAACTTACCTATTGGTGTGCCCTATTCCACATCCTTTAAAAAGTACCATATTGACCATCACCGTTATTTGGGTGGGGATGGCTTGGATGTGGATATCCCAACAGACTTTGAGGGACGTTTTTTCTGTACCCCCATTCGCAAGGTCCTTTGGATAGTAATACAACCTCTGTTGTATGTTCTGCGTCCACTTTATGTCAACCCCAAACCCAAAACTCATCTGGAGATCATAAATGCTCTAGTTCAATTTTCCTTTTACCTAGTAATATATTATCTGTGGGGACTTAGGCCTGTGGCATACTGGAATGGCTGATCATGGCTCTCCCTGGGGTTTCGCCCGATATCAAGGCATTTTATTGCTAAATACTACGTGTTTTTTAAAAGTTATGAAAAGGGGGGCCAAATAATGAACCAACCCAAAATTGGTTACCTTTCCAATTGTTTTGCAATTCGCATAGGGAAAAAATCAAGAAAAATTTCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTAACATGGTTGTAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839362
dbEST ID: 79657064
Trimmed Sequence: GTCCTTCTTTGCTAGTTCACACTCTCTCTTGACACGTGAGAAAGGTCCCAGTTCCTTGCAGAATATAAAATCCCAAAGCACTCTCCCCCATGATGTGTGATATGGAAGGGTGTCATAATACTCCGGAGCGATTTTACGGACCAGTGAAAGTTTGCTCCCAGGGATGCTTGGAAAGTCATGATGTTCCATGTGATAGCCAACATTGAACGTTAACAAGTTGAGTGGTCCATAGTATGAGTATGTTTCATAACCTTTCAAAAACATGTAGTGTTCAGCAATAAAATGCCCTGATATTGGGTGGAACCCCATGGAGAGGCATGATCCAGCAATCAAGTATGCCACAGGCTTAAGTCCCCACAGATAATATATTATTAGGTCAAAGGAAAACTGAACTAGAGCATTTATGATCTCCAGATGAGTTATGGGCTTGGGGTTGACATAAAGTGGACGCAGAACATACAACAGAGGTTGTATTACTATCCAAAGGACCTTGCGAATGGGGGTACAGAAAAAACGTCCCTCANAGTCTGTTGGGATATCCACATCCNAGCCATCCCCACCCAAATAACGGTGATGGTCAATATGGTACTTTTTAAAGGATGTGGAATAGGGCACACCAATAGGTAAGTTAACAAACATGCCAAAGAAGCCGTTTCCACCTTGCTGAATTTGTTTCCCAAAGCTACATTGGTGCGAGATGTCCTGGAAATGGCCCGGGGGTAAGGGGAAATGGGTTTTATTAAACCCCCCCCAAAGGCAAAAAAAAAACAAA
Full Trace Sequence: CGTGAAACNGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTTCTTTGCTAGTTCACACTCTCTCTTGACACGTGAGAAAGGTCCCAGTTCCTTGCAGAATATAAAATCCCAAAGCACTCTCCCCCATGATGTGTGATATGGAAGGGTGTCATAATACTCCGGAGCGATTTTACGGACCAGTGAAAGTTTGCTCCCAGGGATGCTTGGAAAGTCATGATGTTCCATGTGATAGCCAACATTGAACGTTAACAAGTTGAGTGGTCCATAGTATGAGTATGTTTCATAACCTTTCAAAAACATGTAGTGTTCAGCAATAAAATGCCCTGATATTGGGTGGAACCCCATGGAGAGGCATGATCCAGCAATCAAGTATGCCACAGGCTTAAGTCCCCACAGATAATATATTATTAGGTCAAAGGAAAACTGAACTAGAGCATTTATGATCTCCAGATGAGTTATGGGCTTGGGGTTGACATAAAGTGGACGCAGAACATACAACAGAGGTTGTATTACTATCCAAAGGACCTTGCGAATGGGGGTACAGAAAAAACGTCCCTCANAGTCTGTTGGGATATCCACATCCNAGCCATCCCCACCCAAATAACGGTGATGGTCAATATGGTACTTTTTAAAGGATGTGGAATAGGGCACACCAATAGGTAAGTTAACAAACATGCCAAAGAAGCCGTTTCCACCTTGCTGAATTTGTTTCCCAAAGCTACATTGGTGCGAGATGTCCTGGAAATGGCCCGGGGGTAAGGGGAAATGGGTTTTATTAAACCCCCCCCAAAGGCAAAAAAAAAACAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTTCTTTGCTAGTTCACACTC