ORFeome > des.1 ORF1 – XORFeome v1.0

des.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: des.1
Gene ID: 6254678
Gene Page ID: 494930
ORF Xenbase ID: 17272365

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046651
Original XGC clone length: 1377

Human orthology & disease relationships

NCBI Entrez ID: 1674
Ensembl gene IDs: ENSG00000175084,LRG_380
Directly associated (OMIM) disease MIM numbers: 181400,601419,604765,615325
Indirectly associated (Lage, et al.) disease MIM numbers: 115200,123320,131950,192600,215600,226670,601419,604765,606072,607801,608758

Library Location

Plate ID: GDExl11014
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ824166
dbEST ID: 79641868
Trimmed Sequence: ATGAGCCAGTCCTATTCAAGCAACCAGAGGGCTTCCTCCTACCGCCGCACTTTTGGAGGGGGTTCCCCATCATTCAGCACTAGGTCCTCCTTTGGGTCTAAAGGTGCTTCCTCTAGTTCAGTGTCTTCCAGAGTATACCAAGTTTCCAGATCTACAGCGGCCCCAAGCCTCTCCAGTTTTAGAGCAACAAGGGTCGCCCCAGTAAGAAGCAGCTATGGAGCAGATGTTTTGGACTTCAGTCTTGCAGATGCAATGAACCAGGAGTTCCTGCAAACCCGAACCAATGAAAAGGTGGAGCTGCAGGATTTGAACGACAGGTTTGCCAACTATATTGAGAAGGTCCGGTACCTTGAGCAGCAGAATCAGATTCTTGTGGCAGAAGTCAACAGACTAAAGGGAAAGGAGCCCACCAGGGTGAACGAGCTGTATGAGGAAGAGATGAGGGAGCTGCGCCGTCAAGTGGACCTTGTGACCAATCAGAGGGCACGTGTGGAGGTAGAAAGGGACAACCTGGTAGATGACCTTCAAAAGCTTAAGCAGAGGTTGCAGGAGGAGATCCAGTTGAAGGAAGATGCTGAGAACAATCTTGCTGCTTTCAGAGGGGATGTTGATGCTGCTACTCTGGCCCGCATAGACCTGGAGAGACGCATTGAGTCTTTGCAGGAGGAAATTGCATTCCTGAAAAGATTCATGAGGAGGAAATCGGGGACTGCAGGCACAGTTCCAGAGAACAGCTGCAGGTGGAAATAAATGTTTCCAACCAAACCTGACACCACACCACAAAAATCCGGGCCCCATACAAAACATTTCCCCCAAAAGTGGTTTAAACCCCAG
Full Trace Sequence: AATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCAGTCCTATTCAAGCAACCAGAGGGCTTCCTCCTACCGCCGCACTTTTGGAGGGGGTTCCCCATCATTCAGCACTAGGTCCTCCTTTGGGTCTAAAGGTGCTTCCTCTAGTTCAGTGTCTTCCAGAGTATACCAAGTTTCCAGATCTACAGCGGCCCCAAGCCTCTCCAGTTTTAGAGCAACAAGGGTCGCCCCAGTAAGAAGCAGCTATGGAGCAGATGTTTTGGACTTCAGTCTTGCAGATGCAATGAACCAGGAGTTCCTGCAAACCCGAACCAATGAAAAGGTGGAGCTGCAGGATTTGAACGACAGGTTTGCCAACTATATTGAGAAGGTCCGGTACCTTGAGCAGCAGAATCAGATTCTTGTGGCAGAAGTCAACAGACTAAAGGGAAAGGAGCCCACCAGGGTGAACGAGCTGTATGAGGAAGAGATGAGGGAGCTGCGCCGTCAAGTGGACCTTGTGACCAATCAGAGGGCACGTGTGGAGGTAGAAAGGGACAACCTGGTAGATGACCTTCAAAAGCTTAAGCAGAGGTTGCAGGAGGAGATCCAGTTGAAGGAAGATGCTGAGAACAATCTTGCTGCTTTCAGAGGGGATGTTGATGCTGCTACTCTGGCCCGCATAGACCTGGAGAGACGCATTGAGTCTTTGCAGGAGGAAATTGCATTCCTGAAAAGATTCATGAGGAGGAAATCGGGGACTGCAGGCACAGTTCCAGAGAACAGCTGCAGGTGGAAATAAATGTTTCCAACCAAACCTGACACCACACCACAAAAATCCGGGCCCCATACAAAACATTTCCCCCAAAAGTGGTTTAAACCCCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCAGTCCTATTCAAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829471
dbEST ID: 79647173
Trimmed Sequence: CAAAATCTCCTGGTGCTGCTGGGAAGCCTCACTCAAAACCTCACCATCCCTGGTCTCAATCGTCTTGATCATGACTGTTTTCTTTGTGTGAACTTCTGAAGCCCTCTGCTCTGGGCTGGTTTCTCTAAAACTGAGTGCAGAAAATGTTTGGATGGGAAGAGTGATCCTGCTTTCCTCGCCCTCTAGCAGTTTACGGTATGTGGCAATTTCCATGTCAAGTGCCATCTTAACGTTCAGAAGATCCTGATACTCGCGGAGATGCCTTGCCATTTCATCTTTCATATTACGGATCTCTTCCTCTAAACGTCCAATGGTGTCCTGGTACCCAGCAGCTTCCCCAGAAAACTTTTCCTCTAGGTCCCTCATCTGGCGCATCAAGGAGTCATTTGTTCCCTTAAGTGCATCAATCTCGCAGGTGTAGGACTGGATTTGGTGGCGGTACTCCATCATCTCTTGCTTGGACTGGCGCATGGCATCATTGTTCTTCTTAGCTGCCTGGTTGAGGTCACTGACCTTGGACTTGTACCACTCCTCGGCTTCAGCAACATTCTTGGCGGCAATGTTCTCGTACTGAGCCCGGATATCTCTGAATGCTGCTGTCAGGTCTGGTTTGGAAACATCTATCTTCACTTTGCAACTGTTGCTCTTGGAACTGGTGCCTGCAATTCCCGGAATTTCCTTCTTCATGAAATCTTTTTTCAAGGAATGGAAATTTTCCTCCCTGCAAAAAAACTCAATGGCCTTCCCCCTCCAGGGGTCATATGCG
Full Trace Sequence: TGCACGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAATCTCCTGGTGCTGCTGGGAAGCCTCACTCAAAACCTCACCATCCCTGGTCTCAATCGTCTTGATCATGACTGTTTTCTTTGTGTGAACTTCTGAAGCCCTCTGCTCTGGGCTGGTTTCTCTAAAACTGAGTGCAGAAAATGTTTGGATGGGAAGAGTGATCCTGCTTTCCTCGCCCTCTAGCAGTTTACGGTATGTGGCAATTTCCATGTCAAGTGCCATCTTAACGTTCAGAAGATCCTGATACTCGCGGAGATGCCTTGCCATTTCATCTTTCATATTACGGATCTCTTCCTCTAAACGTCCAATGGTGTCCTGGTACCCAGCAGCTTCCCCAGAAAACTTTTCCTCTAGGTCCCTCATCTGGCGCATCAAGGAGTCATTTGTTCCCTTAAGTGCATCAATCTCGCAGGTGTAGGACTGGATTTGGTGGCGGTACTCCATCATCTCTTGCTTGGACTGGCGCATGGCATCATTGTTCTTCTTAGCTGCCTGGTTGAGGTCACTGACCTTGGACTTGTACCACTCCTCGGCTTCAGCAACATTCTTGGCGGCAATGTTCTCGTACTGAGCCCGGATATCTCTGAATGCTGCTGTCAGGTCTGGTTTGGAAACATCTATCTTCACTTTGCAACTGTTGCTCTTGGAACTGGTGCCTGCAATTCCCGGAATTTCCTTCTTCATGAAATCTTTTTTCAAGGAATGGAAATTTTCCTCCCTGCAAAAAAACTCAATGGCCTTCCCCCTCCAGGGGTCATATGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAATCTCCTGGTGCTGCT