ORFeome > dhcr7 ORF1 – XORFeome v1.0

dhcr7 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dhcr7
Gene ID: 920377
Gene Page ID: 920361
ORF Xenbase ID: 17272449

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054203
Original XGC clone length: 1029

Human orthology & disease relationships

NCBI Entrez ID: 1717
Ensembl gene IDs: ENSG00000172893,LRG_340
Directly associated (OMIM) disease MIM numbers: 270400
Indirectly associated (Lage, et al.) disease MIM numbers: 140350,200950,203500,241500,241510,264600,270200,270400,276710,307030,601815,607330,608643

Library Location

Plate ID: GDExl11002
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ839415
dbEST ID: 79657117
Trimmed Sequence: ATGGGTGAGCGGAGAAGAGCGAATGCGTCCAGGGGGGACAAGAAAATGGCCAATGGAGAAAAGCAACATGTGGGTCAGTGGGGCCGAGCCTGGGAAGTGGATTACTTCTCATTGGCCTCAGTCATATTCCTGTTGGCCTTTGCTCCGCTGATTGTCTACTACTTTGTCATGTCATGTGATCAGTATCAGTGCGCCCTCACCTCCCCAGTCCTGGACCTATACTCTGGCAAAGCGCAGCTGTCCGACATCTGGGACAAGACCCCCGCAATCACCTGGACTGCCGTCAAGATCTACCTAGCGTGGGTCTCCTTCCAGGTGTTTCTGTATATGCTCGTTCCTGATATCTTACATAAATTTGTGCCTGGCTACGAGGGTGGAGTGCAAGACGGAGCAAGGACCCCTGCTGGCTTGATAAACAAATACCAAGTCAATGGGCTGCAGGCCTGGACCATCACCCACCTGCTCTGGTTCGCCAACGCCTACCATTTCCACTGGTTCTCCCCAACCATTATCATTGACAACTGGATCCCGCTGCTGTGGTGCGCCAATCTCCTGGGCTATTCTGTCGCCACCTTCGCTTTGGTGAAAGCCTACTTCTTCCCCACCAACGCCGGCGACTGCAAATTCACAGGCAATTTTCTCTACAACTACATGATGGGCATTGAGGTCAACCCCCCCATTGCAAAAGTGGTTCGACCTTCAAACTGTTTCTCCAATGGGCAACCCGGGGATCCTTCGCCCTGGACCTTAATTTAACTTTGTCCCAATGCTGTGCCAGCCAGCAAGAAACCTCTAACGGGGCCAGGGTTCACCCAAT
Full Trace Sequence: TCGCGGGCCCAATAANTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTGAGCGGAGAAGAGCGAATGCGTCCAGGGGGGACAAGAAAATGGCCAATGGAGAAAAGCAACATGTGGGTCAGTGGGGCCGAGCCTGGGAAGTGGATTACTTCTCATTGGCCTCAGTCATATTCCTGTTGGCCTTTGCTCCGCTGATTGTCTACTACTTTGTCATGTCATGTGATCAGTATCAGTGCGCCCTCACCTCCCCAGTCCTGGACCTATACTCTGGCAAAGCGCAGCTGTCCGACATCTGGGACAAGACCCCCGCAATCACCTGGACTGCCGTCAAGATCTACCTAGCGTGGGTCTCCTTCCAGGTGTTTCTGTATATGCTCGTTCCTGATATCTTACATAAATTTGTGCCTGGCTACGAGGGTGGAGTGCAAGACGGAGCAAGGACCCCTGCTGGCTTGATAAACAAATACCAAGTCAATGGGCTGCAGGCCTGGACCATCACCCACCTGCTCTGGTTCGCCAACGCCTACCATTTCCACTGGTTCTCCCCAACCATTATCATTGACAACTGGATCCCGCTGCTGTGGTGCGCCAATCTCCTGGGCTATTCTGTCGCCACCTTCGCTTTGGTGAAAGCCTACTTCTTCCCCACCAACGCCGGCGACTGCAAATTCACAGGCAATTTTCTCTACAACTACATGATGGGCATTGAGGTCAACCCCCCCATTGCAAAAGTGGTTCGACCTTCAAACTGTTTCTCCAATGGGCAACCCGGGGATCCTTCGCCCTGGACCTTAATTTAACTTTGTCCCAATGCTGTGCCAGCCAGCAAGAAACCTCTAACGGGGCCAGGGTTCACCCAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTGAGCGGAGAAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839414
dbEST ID: 79657116
Trimmed Sequence: AACCGAGAGAAGGACCCCAATGGCGGCAGTGGTAGAGAGCTCAATGGGGTTATAAACCAGATATAAACCCTGTAGGGTATAGAGGTAGGGCAACCAGACACAATCTCCCCATCCCAGATACCAGCCAAAGTGGTCATGGCAGATGTCAATAGTCTTCAGGTACCAGGATTCGTTCCAGAAAAAGTCCACTACATAGATTGCCTGAAGAACGTTGACCAGAATCATGGAGTTGGTGACCTGCCCGTAGAGCTCTTGCTGCTTGGCAGCATAGGACAAGTTAATTAAGGTCCAGGCGACGATCCCGGGTCGCCCATTGAAGAACAGTTTGAAGTCGAACCACTTTCCAATGCGGGGGTTGAACTCAATGCCCATCATGTAGTTGTAGAAGAAATTGCCTGTGAATTTGCAGTCGCTGGCGTTGGTGGGGAAGAAGTAGGCTTTCACCAAAGCGAAGGTGGCGACAGAATAGCCCAGGAGATTGGCGCACCACAGCAGCGGGATCCAGTTGTCAATGATAATGGTTGGGGAGAACCAGTGGAAATGGTAGGCGTTGGCGAACCAGAGCAGGTGGGGTGATGGTCCAGGCCTGCAGCCCATTGACTTGGTATTTGTTTATCAAGCCAGCAGGGGGTCCTTGCTCGGTCCTGGACCTCACCCCTCCTAACCCGGCCACCAATTTAATGTAAGAATATTCAGGAACGAAACCATTTAACAAAAACCCCCCGGGAAAAGGAAACCCCCAGCCTAGGGGTAAAATTTTTGGACGC
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACCGAGAGAAGGACCCCAATGGCGGCAGTGGTAGAGAGCTCAATGGGGTTATAAACCAGATATAAACCCTGTAGGGTATAGAGGTAGGGCAACCAGACACAATCTCCCCATCCCAGATACCAGCCAAAGTGGTCATGGCAGATGTCAATAGTCTTCAGGTACCAGGATTCGTTCCAGAAAAAGTCCACTACATAGATTGCCTGAAGAACGTTGACCAGAATCATGGAGTTGGTGACCTGCCCGTAGAGCTCTTGCTGCTTGGCAGCATAGGACAAGTTAATTAAGGTCCAGGCGACGATCCCGGGTCGCCCATTGAAGAACAGTTTGAAGTCGAACCACTTTCCAATGCGGGGGTTGAACTCAATGCCCATCATGTAGTTGTAGAAGAAATTGCCTGTGAATTTGCAGTCGCTGGCGTTGGTGGGGAAGAAGTAGGCTTTCACCAAAGCGAAGGTGGCGACAGAATAGCCCAGGAGATTGGCGCACCACAGCAGCGGGATCCAGTTGTCAATGATAATGGTTGGGGAGAACCAGTGGAAATGGTAGGCGTTGGCGAACCAGAGCAGGTGGGGTGATGGTCCAGGCCTGCAGCCCATTGACTTGGTATTTGTTTATCAAGCCAGCAGGGGGTCCTTGCTCGGTCCTGGACCTCACCCCTCCTAACCCGGCCACCAATTTAATGTAAGAATATTCAGGAACGAAACCATTTAACAAAAACCCCCCGGGAAAAGGAAACCCCCAGCCTAGGGGTAAAATTTTTGGACGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCGAGAGAAGGACCCCA