ORFeome > dhfr ORF1 – XORFeome v1.0

dhfr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dhfr
Gene ID: 975271
Gene Page ID: 975266
ORF Xenbase ID: 17272461

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084841
Original XGC clone length: 570

Human orthology & disease relationships

NCBI Entrez ID: 1719
Ensembl gene IDs: ENSG00000228716
Directly associated (OMIM) disease MIM numbers: 613839
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ840020
dbEST ID: 79657722
Trimmed Sequence: ATGAGGAATCAATTTCTACACGCCGTAGTAGCTGTGTGTCCTCCCAACCAGGGCATTGGCAAAGGGGGATCCCTGCCGTGGCCTCTCCTCAGGAATGAATTCAAACATTTCCAGCGACTCACCATGACACCCACAGTTGAAGGTAAGAAGAATGTAGTAATAATGGGCAGAAAAACATGGTTTTCTATCCCAGAGAAGAACAGACCTTTGAAGGAAAGAATAAATATTGTATTAAGCAAAGAGCTCAAGGAACCACCCACGGGGGCTCACTATCTTTCAAAGAGTTTGACTGAAGCTATAGATCTCCTGGAAGATCCTGAATTAAAAGATAAAGTAGACCTTGTTTGGATTATTGGTGGCAGTTCGCTCTACCAGGAGTTAATGGAAAAGCCAATTAATCAAAGGTGGTTTGTAACCAGAATTTTGCAGGAATTTGAGTGTGATACATATTTACCAGAAATTAACTTGAATTCTTTCCAACTACTTCCTCAATACCCTGGAATATCCCCAGAACTACAAGAAGAAAATGGTGTTCAGTATAAATTTGAGGTGTACGAAAAAATTGTATT
Full Trace Sequence: GGGGGCCCCAAATAATTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGAATCAATTTCTACACGCCGTAGTAGCTGTGTGTCCTCCCAACCAGGGCATTGGCAAAGGGGGATCCCTGCCGTGGCCTCTCCTCAGGAATGAATTCAAACATTTCCAGCGACTCACCATGACACCCACAGTTGAAGGTAAGAAGAATGTAGTAATAATGGGCAGAAAAACATGGTTTTCTATCCCAGAGAAGAACAGACCTTTGAAGGAAAGAATAAATATTGTATTAAGCAAAGAGCTCAAGGAACCACCCACGGGGGCTCACTATCTTTCAAAGAGTTTGACTGAAGCTATAGATCTCCTGGAAGATCCTGAATTAAAAGATAAAGTAGACCTTGTTTGGATTATTGGTGGCAGTTCGCTCTACCAGGAGTTAATGGAAAAGCCAATTAATCAAAGGTGGTTTGTAACCAGAATTTTGCAGGAATTTGAGTGTGATACATATTTACCAGAAATTAACTTGAATTCTTTCCAACTACTTCCTCAATACCCTGGAATATCCCCAGAACTACAAGAAGAAAATGGTGTTCAGTATAAATTTGAGGTGTACGAAAAAATTGTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTTGTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCCATCCACCTAAAATCCCCTATAGTGAAGCGTATTACCTGGAAAAAAAAAAAAAAAAAGAAAGCCCCTGGCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGAATCAATTTCTACACGC

Sequences - 3ʹ (reverse) EST

Accession: JZ840019
dbEST ID: 79657721
Trimmed Sequence: TACAATTTTTTCGTACACCTCAAATTTATACTGAACACCATTTTCTTCTTGTAGTTCTGGGGATATTCCAGGGTATTGAGGAAGTAGTTGGAAAGAATTCAAGTTAATTTCTGGTAAATATGTATCACACTCAAATTCCTGCAAAATTCTGGTTACAAACCACCTTTGATTAATTGGCTTTTCCATTAACTCCTGGTAGAGCGAACTGCCACCAATAATCCAAACAAGGTCTACTTTATCTTTTAATTCAGGATCTTCCAGGAGATCTATAGCTTCAGTCAAACTCTTTGAAAGATAGTGAGCCCCCGTGGGTGGTTCCTTGAGCTCTTTGCTTAATACAATATTTATTCTTTCCTTCAAAGGTCTGTTCTTCTCTGGGATAGAAAACCATGTTTTTCTGCCCATTATTACTACATTCTTCTTACCTTCAACTGTGGGTGTCATGGTGAGTCCCTCGAAATGTTTGAATTCATTCCTGAAGAGAGGCCACGGCAGGGATCCCCCTTTGCCAATGCCCTGGTTTGGAAGACACACAACTACTACAGCGGGTAGAAAATGATTCCTCGTGG
Full Trace Sequence: GAACGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACAATTTTTTCGTACACCTCAAATTTATACTGAACACCATTTTCTTCTTGTAGTTCTGGGGATATTCCAGGGTATTGAGGAAGTAGTTGGAAAGAATTCAAGTTAATTTCTGGTAAATATGTATCACACTCAAATTCCTGCAAAATTCTGGTTACAAACCACCTTTGATTAATTGGCTTTTCCATTAACTCCTGGTAGAGCGAACTGCCACCAATAATCCAAACAAGGTCTACTTTATCTTTTAATTCAGGATCTTCCAGGAGATCTATAGCTTCAGTCAAACTCTTTGAAAGATAGTGAGCCCCCGTGGGTGGTTCCTTGAGCTCTTTGCTTAATACAATATTTATTCTTTCCTTCAAAGGTCTGTTCTTCTCTGGGATAGAAAACCATGTTTTTCTGCCCATTATTACTACATTCTTCTTACCTTCAACTGTGGGTGTCATGGTGAGTCCCTCGAAATGTTTGAATTCATTCCTGAAGAGAGGCCACGGCAGGGATCCCCCTTTGCCAATGCCCTGGTTTGGAAGACACACAACTACTACAGCGGGTAGAAAATGATTCCTCGTGGTGCCAAGGTTTTTTGACAAGGTTGGCATTATAAAAAAACAATGCTCATCAATATAATGCAACCAACAGCGTCACTATCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACAATTTTTTCGTACACCTCA