ORFeome > dhrs7b ORF1 – XORFeome v1.0

dhrs7b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dhrs7b
Gene ID: 946478
Gene Page ID: 946472
ORF Xenbase ID: 17272509

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123346
Original XGC clone length: 972

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ837585
dbEST ID: 79655287
Trimmed Sequence: ATGGATCTGACATCATGGGCTATTTTCCCCTTGCTGCTGGCCAGTATCGGAGTGTACGGCCTGTATAAGCTACTGCAGAAGCTGCGGAGTGGCGCCTACCTACAGGCCGCCGTAGTGGTCATCACCGGAGCAACGTCTGGCTTGGGCAAAGAATGTGCAAAGGTCTTTTATGCAGCTGGCTCTCATCTTGTTTTATGTGGACGTGACGAAGAGAGATTAAAGGATCTAGTGCAGGAACTTAATAACATGCGGTTGAAATCAACTCAGCTGCACAAGCCACACATGGTGATATTTGACCTATCTGATGTGGAAGCTGTGAACACTGCAGCAAAAGAGATCCTGCACCTTGCAGGGAGGGTGGACATTCTCATAAACAATGCTGGTATCAGTTATCGTGGCACAATTCTTGACACAAAGGTCAGCGTGGATAGAATGGTGATGGACACCAACTACTTTGGACCAGTTGCTTTAACAAAAGCTCTCCTTCCATCTATGATCAAGAACAGACGTGGGCACGTTGTTGTAATAAGCAGTGTTCAAGGCAAAATAAGTATCCCTTTCAGATCAGCCTATTCAGCATCAAAACATGCAACACAGGCCTTTTTCGACTGTCTGAGGGCAGAGATGTCACCATATGAAATTGATGTCACAGTTGTAAACCCCGGGCTACCTAAAAGCAAACTATCCATTAAATGCATCACCTGGGGGACGGTTTCCGGTTTTGGGGGTTTATGGGATAGGAAAACCAGGGCAAATGGAAAAAAACACCAAGAAAGAAAATTTTCCCCAGACGGGTGTTCTATTT
Full Trace Sequence: GCGGGGCCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCTGACATCATGGGCTATTTTCCCCTTGCTGCTGGCCAGTATCGGAGTGTACGGCCTGTATAAGCTACTGCAGAAGCTGCGGAGTGGCGCCTACCTACAGGCCGCCGTAGTGGTCATCACCGGAGCAACGTCTGGCTTGGGCAAAGAATGTGCAAAGGTCTTTTATGCAGCTGGCTCTCATCTTGTTTTATGTGGACGTGACGAAGAGAGATTAAAGGATCTAGTGCAGGAACTTAATAACATGCGGTTGAAATCAACTCAGCTGCACAAGCCACACATGGTGATATTTGACCTATCTGATGTGGAAGCTGTGAACACTGCAGCAAAAGAGATCCTGCACCTTGCAGGGAGGGTGGACATTCTCATAAACAATGCTGGTATCAGTTATCGTGGCACAATTCTTGACACAAAGGTCAGCGTGGATAGAATGGTGATGGACACCAACTACTTTGGACCAGTTGCTTTAACAAAAGCTCTCCTTCCATCTATGATCAAGAACAGACGTGGGCACGTTGTTGTAATAAGCAGTGTTCAAGGCAAAATAAGTATCCCTTTCAGATCAGCCTATTCAGCATCAAAACATGCAACACAGGCCTTTTTCGACTGTCTGAGGGCAGAGATGTCACCATATGAAATTGATGTCACAGTTGTAAACCCCGGGCTACCTAAAAGCAAACTATCCATTAAATGCATCACCTGGGGGACGGTTTCCGGTTTTGGGGGTTTATGGGATAGGAAAACCAGGGCAAATGGAAAAAAACACCAAGAAAGAAAATTTTCCCCAGACGGGTGTTCTATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCTGACATCATGGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837584
dbEST ID: 79655286
Trimmed Sequence: AATACAAACCGTTATTTTGGCTTTAAGATTAGAATTAGTTATGAATCCTTTAGCTTTCGTTCTTTTTTTAGCTCTCGCTGACATAATGGAGAAGAATAATGTTGGGGCGAGAGTTCTTAAATATACTGCCAGAGTGGGCACCAAGCCAGCCACCAACAACTCCTTCCTTCTTTCACCCACAGCACGTAGAACAGTCTGTGCAACCTCTTCTGGTGTTCTTCCATCTGCTGTGTTCTTATCCATAACCCCATAACCGGAACCGTCACCAGTGACTGCATTCAATGACAGATTTGTTTTTATATACCCGGGGTTTACAACTGTGACATCAATATCATATGGTGACATCTCTGCCCTCAGACAGTCGAAAAAGGCCTGTGTTGCATGTTTTGATGCTGAATAGGCTGATCTGAAAGGGATACTTATTTTGCCTTGAACACTGCTTATTACAACAACGTGCCCACGTCTGTTCTTGATCATAGATGGAAAGAGAGCTTTTGTTAAAGCAACTGGTCCAAAGTAGTTGGTGTCCATCACCATTCTATCCACGCTGACCTTTGTGTCAAGAATTGTGGCCACATAACTGAATACCGCCATTGTTTAAGAGAATGGTCACCCTTCCCTGCAAGGTGCAGGAATCTCCTTTGCTGCAAGGGTGCCACAGCTTCCACATCCAAAAAAGGTCAAATTATCCCCAGGTGGTGGGCTTGGGGCCGGGTGAAAGTTGAAATTCACACCCCCCAAGGGTAATATAAGTTTCCCCTGGCGACATAAAAATCCCTTT
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATACAAACCGTTATTTTGGCTTTAAGATTAGAATTAGTTATGAATCCTTTAGCTTTCGTTCTTTTTTTAGCTCTCGCTGACATAATGGAGAAGAATAATGTTGGGGCGAGAGTTCTTAAATATACTGCCAGAGTGGGCACCAAGCCAGCCACCAACAACTCCTTCCTTCTTTCACCCACAGCACGTAGAACAGTCTGTGCAACCTCTTCTGGTGTTCTTCCATCTGCTGTGTTCTTATCCATAACCCCATAACCGGAACCGTCACCAGTGACTGCATTCAATGACAGATTTGTTTTTATATACCCGGGGTTTACAACTGTGACATCAATATCATATGGTGACATCTCTGCCCTCAGACAGTCGAAAAAGGCCTGTGTTGCATGTTTTGATGCTGAATAGGCTGATCTGAAAGGGATACTTATTTTGCCTTGAACACTGCTTATTACAACAACGTGCCCACGTCTGTTCTTGATCATAGATGGAAAGAGAGCTTTTGTTAAAGCAACTGGTCCAAAGTAGTTGGTGTCCATCACCATTCTATCCACGCTGACCTTTGTGTCAAGAATTGTGGCCACATAACTGAATACCGCCATTGTTTAAGAGAATGGTCACCCTTCCCTGCAAGGTGCAGGAATCTCCTTTGCTGCAAGGGTGCCACAGCTTCCACATCCAAAAAAGGTCAAATTATCCCCAGGTGGTGGGCTTGGGGCCGGGTGAAAGTTGAAATTCACACCCCCCAAGGGTAATATAAGTTTCCCCTGGCGACATAAAAATCCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATACAAACCGTTATTTTGGCT