ORFeome > dhrs9 ORF1 – XORFeome v1.0

dhrs9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dhrs9
Gene ID: 6253621
Gene Page ID: 973204
ORF Xenbase ID: 17272515

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056045
Original XGC clone length: 1026

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ824605
dbEST ID: 79642307
Trimmed Sequence: ATGTTTCTGTACATGTGGGTCTGTGTAGCCATTCTGTACATCTGGTGGAAAGTGAGGGATGGATTAAGAATCAATAATATCACAGAGAAATATATACTGATTACTGGATGTGACACAGGATTTGGGAACCATGCGGCCAAGGCATTTGATAAACAAGGATTCAGAGTCCTTGCGACATGCCTGACGGATGCTGGAGCCACGGGCCTGAGAGAGGCAACATCAGAACGGCTGAAAACAATACGGCTGGATGTGACTAATGCTGACAATGTCTTATCAGTGGCCAAATGGGTGAAAGGTGAAGTTGGGAATAAAGGACTTTGGGGTTTAATTAATAATGCTGGAATAATGGGAACCCTTGCACCTTTTGATTGGATGACCATTGACGACATCAGGAAGCCAATTGAGGTCAATTTGATTGGTTTAATACATGTGACACTGGTCCTGTTGCCGTTTATCAAGAAAGCAAAGGGAAGAATAGTGAATGTATCCAGCGTTGGTGGAAGAGTTGCAGCTAGTGGAGGTGCATACTTTTCATCTAAATTTNGGAGTTGAAGGATTTAACGACAGCTTACGACGAGATATGAAAGCATTTGGAGTAAAAGTGTCGTGCTTGAACCCTGGATGTTCAAAACACCCCTTTCAGACCCAGCAAAGGTATACAACAGCGAACGGATATCTGGAAGAGACTGCCTGTGGAAATCAAAAAGAAATATGAAAATAATATATACCAAATAAATGCCAGCAAAGAACAGAAACTGAAACAACCCTCCCAAACATGACCCCCCCTTTTGGGGGGGCCCCGGGGGGTGGGAAAAGCTTTATAAAACCCCCCCTC
Full Trace Sequence: TAATGAATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTCTGTACATGTGGGTCTGTGTAGCCATTCTGTACATCTGGTGGAAAGTGAGGGATGGATTAAGAATCAATAATATCACAGAGAAATATATACTGATTACTGGATGTGACACAGGATTTGGGAACCATGCGGCCAAGGCATTTGATAAACAAGGATTCAGAGTCCTTGCGACATGCCTGACGGATGCTGGAGCCACGGGCCTGAGAGAGGCAACATCAGAACGGCTGAAAACAATACGGCTGGATGTGACTAATGCTGACAATGTCTTATCAGTGGCCAAATGGGTGAAAGGTGAAGTTGGGAATAAAGGACTTTGGGGTTTAATTAATAATGCTGGAATAATGGGAACCCTTGCACCTTTTGATTGGATGACCATTGACGACATCAGGAAGCCAATTGAGGTCAATTTGATTGGTTTAATACATGTGACACTGGTCCTGTTGCCGTTTATCAAGAAAGCAAAGGGAAGAATAGTGAATGTATCCAGCGTTGGTGGAAGAGTTGCAGCTAGTGGAGGTGCATACTTTTCATCTAAATTTNGGAGTTGAAGGATTTAACGACAGCTTACGACGAGATATGAAAGCATTTGGAGTAAAAGTGTCGTGCTTGAACCCTGGATGTTCAAAACACCCCTTTCAGACCCAGCAAAGGTATACAACAGCGAACGGATATCTGGAAGAGACTGCCTGTGGAAATCAAAAAGAAATATGAAAATAATATATACCAAATAAATGCCAGCAAAGAACAGAAACTGAAACAACCCTCCCAAACATGACCCCCCCTTTTGGGGGGGCCCCGGGGGGTGGGAAAAGCTTTATAAAACCCCCCCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCTGTACATGTGGGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829955
dbEST ID: 79647657
Trimmed Sequence: AGGCCCTGTGTTGTTATTTAAATGAAATTGAGTATTATCGACATCTGTTCTCAGAGCATGCGTTGTGTTGCCTGAAGTGGGGATTTTAACTTTGTTTCTCAAGATAACAAAGTCTTGAATAAACGTCGGCATATAGGACAATGGTATCCAAAGAAATGCTGCATCAAAGCCTGCGCTATAACGTGTCCTTGGATGGCGGCTTGTTAGAGCATGTTCCATGCACTGGACCACCAACGAGAGGTCACTGTTTAGGATGCGCTGGTTCAGCTTCTGTTTCTTGCTGGCATCTATTTGTATATAATTATCTCCATATTCTTTCTTGATTTCCACAGGCAGTCTCTTCCAGATATCCGTTCGCTGTTGTATAACCTTTGCTGGGTCTGAAAGGGGTGTTTTGAACAATCCAGGTTCAATGCACGACACTTTTACTCCAAATGCTTTCATATCTCGTCGTAAGCTGTCGTTAAATCCTTCAACTCCAAATTTAGATGAAAAGTATGCACCTCCACTAGCTGCAACTCTTCCACCAACGCTGGATACATTCACTATTCTTCCCTTTGCTTTCTTGATAAACGGCAACAGGACCAGTGTCACATGTATTAAACCAATCAAATTGACCTCAATTGGCTTCCTGATGTCGTCAATGGTCATCCAATCAAAAGGTGCAAGGGGTCCCCATTATTTCCAGCATTATAAATTAAAACCCCAAAAGTCCTTTAATCCTCAACTTTCCCCCTTTTCCCCCATTTGTGGCCCCCGGAATATAAAACAT
Full Trace Sequence: CGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGCCCTGTGTTGTTATTTAAATGAAATTGAGTATTATCGACATCTGTTCTCAGAGCATGCGTTGTGTTGCCTGAAGTGGGGATTTTAACTTTGTTTCTCAAGATAACAAAGTCTTGAATAAACGTCGGCATATAGGACAATGGTATCCAAAGAAATGCTGCATCAAAGCCTGCGCTATAACGTGTCCTTGGATGGCGGCTTGTTAGAGCATGTTCCATGCACTGGACCACCAACGAGAGGTCACTGTTTAGGATGCGCTGGTTCAGCTTCTGTTTCTTGCTGGCATCTATTTGTATATAATTATCTCCATATTCTTTCTTGATTTCCACAGGCAGTCTCTTCCAGATATCCGTTCGCTGTTGTATAACCTTTGCTGGGTCTGAAAGGGGTGTTTTGAACAATCCAGGTTCAATGCACGACACTTTTACTCCAAATGCTTTCATATCTCGTCGTAAGCTGTCGTTAAATCCTTCAACTCCAAATTTAGATGAAAAGTATGCACCTCCACTAGCTGCAACTCTTCCACCAACGCTGGATACATTCACTATTCTTCCCTTTGCTTTCTTGATAAACGGCAACAGGACCAGTGTCACATGTATTAAACCAATCAAATTGACCTCAATTGGCTTCCTGATGTCGTCAATGGTCATCCAATCAAAAGGTGCAAGGGGTCCCCATTATTTCCAGCATTATAAATTAAAACCCCAAAAGTCCTTTAATCCTCAACTTTCCCCCTTTTCCCCCATTTGTGGCCCCCGGAATATAAAACAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGCCCTGTGTTGTTATTTAAATG