ORFeome > dhrsx ORF1 – XORFeome v1.0

dhrsx ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dhrsx
Gene ID: 5952447
Gene Page ID: 5952438
ORF Xenbase ID: 17272521

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078616
Original XGC clone length: 984

Human orthology & disease relationships

NCBI Entrez ID: 207063
Ensembl gene IDs: ENSG00000169084
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,227650

Library Location

Plate ID: GDExl11004
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ839830
dbEST ID: 79657532
Trimmed Sequence: ATGTGGCTCGTGTCTGTGCTGCTGCCCATCCTGAGGGTCTATTACACGGGCCTGAGAGTCATCCTCCAACAAATGTGCGGCGGCCTCGCATTCTCCCATCCAGCATTCTCATCACAAAACGGAAAAGTTGCTATAGTCACAGGAGGTGCCAAGGGAATAGGATGCAGCACTGCAAAACAACTGTCAAGACTTGGCATGCACGTGATAATAGCTGGAAATAATGAAGCTGAAGGCAATGAAGCAGTGACTCGAATACAGCAAGACACTCAGAATGAGAAAGTGGAATTTTTATATTGTGATTTGGCTTCCATGAAGTCCATCCGGCAGTTCGTCCAGAATTTCACAGCAAAAAACCTCTGCCTTCATGTGTTGGTGAATAATGCTGGTGTAATGTTGGTACCTGAGCGCAAAACAGCAGATGGCTTTGAGGAACATTTTGGCTTAAATTATCTGGGGCATTTCTTACTGACAAACCTTCTACTGAAAACGATGAAAAAATCAGGAACGGAAAACTTGAATGCTCGCATCATCACAGTCTCATCTGCTACCCATTATGTTGGAGAGCTGAACTTTGATGATCTCAATAGCAGCTACTGCTATTCTCCGCATGGTGCGTATGCTCAGAGCAAGCTCGCCCCTGGTGATGTTCACCTATTGCTTACAACGTCACCTGTCTTAAGATGGGTGCTACGTAACTGCCAATGCGTTGAAACCCGGAGTCGTGAATACTGACCTCTACCGAAAATTGTGCCGGCCAGGCAGGCCTGGTGAGTGGTTTTAAAAAGCATGGGCTGTTTTTTAAAAAAATTCAAACTAAAAGGTTCC
Full Trace Sequence: GGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCTCGTGTCTGTGCTGCTGCCCATCCTGAGGGTCTATTACACGGGCCTGAGAGTCATCCTCCAACAAATGTGCGGCGGCCTCGCATTCTCCCATCCAGCATTCTCATCACAAAACGGAAAAGTTGCTATAGTCACAGGAGGTGCCAAGGGAATAGGATGCAGCACTGCAAAACAACTGTCAAGACTTGGCATGCACGTGATAATAGCTGGAAATAATGAAGCTGAAGGCAATGAAGCAGTGACTCGAATACAGCAAGACACTCAGAATGAGAAAGTGGAATTTTTATATTGTGATTTGGCTTCCATGAAGTCCATCCGGCAGTTCGTCCAGAATTTCACAGCAAAAAACCTCTGCCTTCATGTGTTGGTGAATAATGCTGGTGTAATGTTGGTACCTGAGCGCAAAACAGCAGATGGCTTTGAGGAACATTTTGGCTTAAATTATCTGGGGCATTTCTTACTGACAAACCTTCTACTGAAAACGATGAAAAAATCAGGAACGGAAAACTTGAATGCTCGCATCATCACAGTCTCATCTGCTACCCATTATGTTGGAGAGCTGAACTTTGATGATCTCAATAGCAGCTACTGCTATTCTCCGCATGGTGCGTATGCTCAGAGCAAGCTCGCCCCTGGTGATGTTCACCTATTGCTTACAACGTCACCTGTCTTAAGATGGGTGCTACGTAACTGCCAATGCGTTGAAACCCGGAGTCGTGAATACTGACCTCTACCGAAAATTGTGCCGGCCAGGCAGGCCTGGTGAGTGGTTTTAAAAAGCATGGGCTGTTTTTTAAAAAAATTCAAACTAAAAGGTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCTCGTGTCTGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839829
dbEST ID: 79657531
Trimmed Sequence: CGCTGAATCAGGAATTCCAGCCATTTTGCAGCTTTCATTCCACAGTTTTCTTTGCAGCTCCTCGTTGTATGATACGTCTGCAGATTTTGTCTTTTGTCCACTGTACAAATAACAGCCTCCAATTCCTTCCAGCTCTGGTGCGACTGATGCATAAACTGACGTGGCTGCACCTTCGTCTGGAGTCTTAAAAAACAGCCATGCTGTCAACCACTTCACCAGCCTGCCTGGCCAGCACACATTCCGGTAGAGGTCAGTATTCACGACTCCGGGATCCACCGCATTGGCAGTTACGTAGCACCCATCTTCAGACAGCTGACGTTGTAAGCAATAGGTGAACATCACCAGGGCGAGCTTGCTCTGAGCATACGCACCATGCGGAGAATAGCAGTAGCTGCTATTGAGATCATCAAAGTTCAGCTCTCCAACATAATGGGTAGCAGATGAGACTGTGATGATGCGAGCATTCAAGTTTTCCGTTCCTGATTTTTTCATCGTTTTCAGTAGAAGGTTTGTCAGTAAGAAATGCCCCAGATAATTTAAGCCAAAATGTTCCTCANAGCCATCTGCTGTTTTGCGCTCAGGTACCAACATTACACCAGCATTATTCACCACACATGAAGGCAAAGGTTTTTTGCTGTGAAATTTCTGGAGAAATGGCCGATGGACTTCATGGAAACCAAATCACAATATAAAATTTCCACTTTCTCATTCCGGAGTGTCCTTGCCTGTATTTAAATCCCCTGGCTCCTTGGCCTTCAACCTTTCT
Full Trace Sequence: GGGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCTGAATCAGGAATTCCAGCCATTTTGCAGCTTTCATTCCACAGTTTTCTTTGCAGCTCCTCGTTGTATGATACGTCTGCAGATTTTGTCTTTTGTCCACTGTACAAATAACAGCCTCCAATTCCTTCCAGCTCTGGTGCGACTGATGCATAAACTGACGTGGCTGCACCTTCGTCTGGAGTCTTAAAAAACAGCCATGCTGTCAACCACTTCACCAGCCTGCCTGGCCAGCACACATTCCGGTAGAGGTCAGTATTCACGACTCCGGGATCCACCGCATTGGCAGTTACGTAGCACCCATCTTCAGACAGCTGACGTTGTAAGCAATAGGTGAACATCACCAGGGCGAGCTTGCTCTGAGCATACGCACCATGCGGAGAATAGCAGTAGCTGCTATTGAGATCATCAAAGTTCAGCTCTCCAACATAATGGGTAGCAGATGAGACTGTGATGATGCGAGCATTCAAGTTTTCCGTTCCTGATTTTTTCATCGTTTTCAGTAGAAGGTTTGTCAGTAAGAAATGCCCCAGATAATTTAAGCCAAAATGTTCCTCANAGCCATCTGCTGTTTTGCGCTCAGGTACCAACATTACACCAGCATTATTCACCACACATGAAGGCAAAGGTTTTTTGCTGTGAAATTTCTGGAGAAATGGCCGATGGACTTCATGGAAACCAAATCACAATATAAAATTTCCACTTTCTCATTCCGGAGTGTCCTTGCCTGTATTTAAATCCCCTGGCTCCTTGGCCTTCAACCTTTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCTGAATCAGGAATTCCAGCCAT