ORFeome > diexf ORF1 – XORFeome v1.0

diexf ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: diexf
Gene ID: 1002192
Gene Page ID: 1002186
ORF Xenbase ID: 17272563

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128692
Original XGC clone length: 2313

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ837354
dbEST ID: 79655056
Trimmed Sequence: ATGGGGAAGAGGAGGAAGCCCCGGAGGGACGAGGCTATTAGCGCCTTGAGTAAGAAGCAGAAGAAGCACCTGAAGGAATTTGGGGAACAGCACCCCTTCTATGATGCAGTCTCCAAAAAACAAGAAGTAACCCAAGTCATTCAGCTGCCTGAGAGCTCAGAGGATGAATCCAGAAGTGAGAGCGAGGCAGAGAGTGAGCCAGAGCAGGTCAATATGTACCACCAACTCCTCGCCACCTTGAAAAGTGTTTCAGAGGAAGAGGAAGAAGAAAGTGATGATGATGATGATGTAGAAGAAGAAACCGTAGAAGATGAAGGCGATGATGCAGAAGAAATGGATGAGGAATCTGAAGCAGAAAATGAGGATGTTGAAGATGAGAGTGAAGGGGAAGTATCTGGAGAAGACTATGGGGCAACGGATGGGATAACTGGAGAGGAGCAGAAAGAGGCAGATGATGAGGAGGACGTGGTAGTTGGATATACAGCTTGGAAGTAAATCTGCGTGGGCTCTTCTGCGAGGCATAAATCTGAGTTACGGTTCAAAACAGATGTATTGAAGGCGGCGGCGGACGGGGATGATTGTAAGAAGAGACCTGCTCTCCTGTTCACTGGGGGGGGCACCAAAAACCCTTTTTGTCTGCCAGGGCCCAAGGGGAGCAGAGAAGACCAAAAAATCAGGGAGGAACGGGCCTCAACCACAAAAAAGAGCCTCCTGGAGGGCGGGCGGGCGGGGGGGAGGAGAGGAGGAAACCCTCGGGGTCTCCCTCTCGGGGGGGGGCGGCGGGCGGTAAAGGAAGAGGGGAAAAGGGAGGGGG
Full Trace Sequence: TCGTGGGCCCATATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGAGGAGGAAGCCCCGGAGGGACGAGGCTATTAGCGCCTTGAGTAAGAAGCAGAAGAAGCACCTGAAGGAATTTGGGGAACAGCACCCCTTCTATGATGCAGTCTCCAAAAAACAAGAAGTAACCCAAGTCATTCAGCTGCCTGAGAGCTCAGAGGATGAATCCAGAAGTGAGAGCGAGGCAGAGAGTGAGCCAGAGCAGGTCAATATGTACCACCAACTCCTCGCCACCTTGAAAAGTGTTTCAGAGGAAGAGGAAGAAGAAAGTGATGATGATGATGATGTAGAAGAAGAAACCGTAGAAGATGAAGGCGATGATGCAGAAGAAATGGATGAGGAATCTGAAGCAGAAAATGAGGATGTTGAAGATGAGAGTGAAGGGGAAGTATCTGGAGAAGACTATGGGGCAACGGATGGGATAACTGGAGAGGAGCAGAAAGAGGCAGATGATGAGGAGGACGTGGTAGTTGGATATACAGCTTGGAAGTAAATCTGCGTGGGCTCTTCTGCGAGGCATAAATCTGAGTTACGGTTCAAAACAGATGTATTGAAGGCGGCGGCGGACGGGGATGATTGTAAGAAGAGACCTGCTCTCCTGTTCACTGGGGGGGGCACCAAAAACCCTTTTTGTCTGCCAGGGCCCAAGGGGAGCAGAGAAGACCAAAAAATCAGGGAGGAACGGGCCTCAACCACAAAAAAGAGCCTCCTGGAGGGCGGGCGGGCGGGGGGGAGGAGAGGAGGAAACCCTCGGGGTCTCCCTCTCGGGGGGGGGCGGCGGGCGGTAAAGGAAGAGGGGAAAAGGGAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGAGGAGGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837353
dbEST ID: 79655055
Trimmed Sequence: ACCGTTTTCTCCGGTAACAAAAAGGTGCACATTTTTCTTAGACTGCAGCATCTGCGCGGCACGCTCTGCCCCCACCACAGCGGCCAGTCTCTGGGCATCATACTTCGAGTAAAGCACAGTGCAGGTCCACGTGGCTTCCTCCCCCCGGTGCCACGCTTTCATCATATTGCACACGTCGCTGTAAAAATGGGGATAAGTACGGAGCTCGTATAAGACAAAGTTTCGGATACCTTTCAACGTGTATCTCTTGTATAAGTGAAAACTCTCGGAGACCACCACAAACTATCTCTCCCCCATCAGGAAGAACTGCCGAGCTCTGGAGATTCCGGGCTTGTTCGTGTATTCGCAAACGTGCGTGAAGTTCAGTTCTTCCTTCTTGAAGTAGTTCCGGAGTCGCACGTAGTCGAAGTAGGAAGGGATATAGATGAGCGTATGAGACATGATGGCATCCCGATACTGCGGCAGAATCTTGCTGGTAAAGAACTCGAACCTGGCATCTATGACAGAAAGCAACCCCTCTGCCTCTAACCTCTGGAAAAAGTGTGGGAAGCTGGACCACAACTGAACTGATAAATCCGTAATAAGCATTGTTCCACCTGCCCACCTGCCCAAATAAATTAAAGCAATGCTTTGTTGAATTATGAAATTAATCTGGGTGCCCCCGGGGGGGAAGCTAAGCAAACAGACGGTTGGCCCGCATAGTTACCTTGGCCCCAATTTGCGTAAGGGGTCCGGAGTGGGGGGAAACAAAAAAAGA
Full Trace Sequence: GAAAATGACTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCGTTTTCTCCGGTAACAAAAAGGTGCACATTTTTCTTAGACTGCAGCATCTGCGCGGCACGCTCTGCCCCCACCACAGCGGCCAGTCTCTGGGCATCATACTTCGAGTAAAGCACAGTGCAGGTCCACGTGGCTTCCTCCCCCCGGTGCCACGCTTTCATCATATTGCACACGTCGCTGTAAAAATGGGGATAAGTACGGAGCTCGTATAAGACAAAGTTTCGGATACCTTTCAACGTGTATCTCTTGTATAAGTGAAAACTCTCGGAGACCACCACAAACTATCTCTCCCCCATCAGGAAGAACTGCCGAGCTCTGGAGATTCCGGGCTTGTTCGTGTATTCGCAAACGTGCGTGAAGTTCAGTTCTTCCTTCTTGAAGTAGTTCCGGAGTCGCACGTAGTCGAAGTAGGAAGGGATATAGATGAGCGTATGAGACATGATGGCATCCCGATACTGCGGCAGAATCTTGCTGGTAAAGAACTCGAACCTGGCATCTATGACAGAAAGCAACCCCTCTGCCTCTAACCTCTGGAAAAAGTGTGGGAAGCTGGACCACAACTGAACTGATAAATCCGTAATAAGCATTGTTCCACCTGCCCACCTGCCCAAATAAATTAAAGCAATGCTTTGTTGAATTATGAAATTAATCTGGGTGCCCCCGGGGGGGAAGCTAAGCAAACAGACGGTTGGCCCGCATAGTTACCTTGGCCCCAATTTGCGTAAGGGGTCCGGAGTGGGGGGAAACAAAAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCGTTTTCTCCGGTAACA