ORFeome > dkk3 ORF1 – XORFeome v1.0

dkk3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dkk3
Gene ID: 877187
Gene Page ID: 877182
ORF Xenbase ID: 17272611

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124937
Original XGC clone length: 873

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ837279
dbEST ID: 79654981
Trimmed Sequence: ATGCCCACCTGCCTGCTCCTCATTCTGCCCCTGCTCTTCTTGGGCACCGTGACCCCTTCCCCAACCAGGAGCCCCTCAGAGAGTGAAGAATTCCTGGAGGCTGGTGGTGCCTCCCAAATGGATCCTATGTTCAGCTTTACAGAGGAGGAGGAGAGCCTGAATGACATGTTCAGGGAAGTGGAAGAGTTAATGGAGGACACTCAGTCTAAGCTGCAGAATGCAGTCAAAGAGATGGAGGCAGAGGAGGCTCACGGGTTACCAGGATGGGCCCAGCTACCTCCTAATTATCATAATGACTCCATCGTGGAGACGGAGGTTGGAAATGAAACCATCAGCATGCAGAAAGAAATCATTAAGAACACGGATAATCGCACAGGTTCCACGTTGTACTCACAGACTGTTATCACTTCTGTGAAGAGTAAAGAGAAACAGCAGCAAGAGTGCATTGTTGACGAGGACTGTAAAGCTGGGAATTACTGTCATTTTGGAGATTCAGAATACAGATGTCTCCTTTGCAAAGTGATGAAGCCGTGCACAAGGGACGGGGAATGCTGCGAGGGTCTCTGTGTTTGGGGTCAGTGCGCCNATGTTTTGAAAAGAGAGGGGGGAACCATCTGTGAGACCCAAGAGGATTGCAACCCCGGATTCTGCTGCTCAGTTCACTCAAATCTCCTGTTTCCTGTTTGCCCCCCTCTGCCCATTAAAGGGGAACCTTTGCTTTCAACCATCCCCATAAATTCTTAAAACATACCTGAACTGGGACCTGCAACCCCGGCCCCGAAGTTTTTTGGGGCCCGTGGCCCCCCTTCCTCCCT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCACCTGCCTGCTCCTCATTCTGCCCCTGCTCTTCTTGGGCACCGTGACCCCTTCCCCAACCAGGAGCCCCTCAGAGAGTGAAGAATTCCTGGAGGCTGGTGGTGCCTCCCAAATGGATCCTATGTTCAGCTTTACAGAGGAGGAGGAGAGCCTGAATGACATGTTCAGGGAAGTGGAAGAGTTAATGGAGGACACTCAGTCTAAGCTGCAGAATGCAGTCAAAGAGATGGAGGCAGAGGAGGCTCACGGGTTACCAGGATGGGCCCAGCTACCTCCTAATTATCATAATGACTCCATCGTGGAGACGGAGGTTGGAAATGAAACCATCAGCATGCAGAAAGAAATCATTAAGAACACGGATAATCGCACAGGTTCCACGTTGTACTCACAGACTGTTATCACTTCTGTGAAGAGTAAAGAGAAACAGCAGCAAGAGTGCATTGTTGACGAGGACTGTAAAGCTGGGAATTACTGTCATTTTGGAGATTCAGAATACAGATGTCTCCTTTGCAAAGTGATGAAGCCGTGCACAAGGGACGGGGAATGCTGCGAGGGTCTCTGTGTTTGGGGTCAGTGCGCCNATGTTTTGAAAAGAGAGGGGGGAACCATCTGTGAGACCCAAGAGGATTGCAACCCCGGATTCTGCTGCTCAGTTCACTCAAATCTCCTGTTTCCTGTTTGCCCCCCTCTGCCCATTAAAGGGGAACCTTTGCTTTCAACCATCCCCATAAATTCTTAAAACATACCTGAACTGGGACCTGCAACCCCGGCCCCGAAGTTTTTTGGGGCCCGTGGCCCCCCTTCCTCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCACCTGCCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837278
dbEST ID: 79654980
Trimmed Sequence: TTTTCTCACCAGTCCGACCAATAAGCAGTCAAGGAAGTTGTCGAGAGAAAGAGGCTGGCACACTAGTCCGAGGGAGCAGGGGCACCGGCCCAAAACTCCGGCAGGCTGCACGTCCCAGTTCAGTATGTCTACGAATTTATTGGATGGGTCGAAGCAAGGTTCCCCTTTAACTGGCAGAGGGGTGCAAACAGGGAACAGGAGATTTGAGTGAACTGAGCAGCAGAATCCGGGGTTGCAATCCTCTTGGCTCTCACAGATGGTTCCCCCCTCTCCTTTCAAAACATTGGCGCACTGACCCCAAACACAGAGACCCTCGCAGCATTCCCCGTCCCTTGTGCACGGCTTCATCACTTTGCAAAGGAGACATCTGTATTCTGAATCTCCAAAATGACAGTAATTCCCAGCTTTACAGTCCTCGTCAACAATGCACTCTTGCTGCTGTTTCTCTTTACTCTTCACAGAAGTGATAACAGTCTGTGAGTACAACGTTGGAACCTGTGCGATTATCCGTGTTCTTAATGAATTCTTTCTGCATGCTGGATGTTTTCATTTTCCACCTCCCTCCTCCCCAATGGAGTCATTATGATAATTAAGAAGGTAACTGGGGCCCATCGGTGGTACCCGGGGAGCCTCCGCGTCCCTCCATCTCTTTTGACCTGCATTCCTGCAGCTTAAAAAGAGAAGTGTCATCCCGGTAACTTCTTCCAACTTTCCCTGAAAGATTTGC
Full Trace Sequence: GGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTCTCACCAGTCCGACCAATAAGCAGTCAAGGAAGTTGTCGAGAGAAAGAGGCTGGCACACTAGTCCGAGGGAGCAGGGGCACCGGCCCAAAACTCCGGCAGGCTGCACGTCCCAGTTCAGTATGTCTACGAATTTATTGGATGGGTCGAAGCAAGGTTCCCCTTTAACTGGCAGAGGGGTGCAAACAGGGAACAGGAGATTTGAGTGAACTGAGCAGCAGAATCCGGGGTTGCAATCCTCTTGGCTCTCACAGATGGTTCCCCCCTCTCCTTTCAAAACATTGGCGCACTGACCCCAAACACAGAGACCCTCGCAGCATTCCCCGTCCCTTGTGCACGGCTTCATCACTTTGCAAAGGAGACATCTGTATTCTGAATCTCCAAAATGACAGTAATTCCCAGCTTTACAGTCCTCGTCAACAATGCACTCTTGCTGCTGTTTCTCTTTACTCTTCACAGAAGTGATAACAGTCTGTGAGTACAACGTTGGAACCTGTGCGATTATCCGTGTTCTTAATGAATTCTTTCTGCATGCTGGATGTTTTCATTTTCCACCTCCCTCCTCCCCAATGGAGTCATTATGATAATTAAGAAGGTAACTGGGGCCCATCGGTGGTACCCGGGGAGCCTCCGCGTCCCTCCATCTCTTTTGACCTGCATTCCTGCAGCTTAAAAAGAGAAGTGTCATCCCGGTAACTTCTTCCAACTTTCCCTGAAAGATTTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCTCACCAGTCCGACCA