ORFeome > dlat ORF1 – XORFeome v1.0

dlat ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dlat
Gene ID: 982540
Gene Page ID: 982533
ORF Xenbase ID: 17272617

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124833
Original XGC clone length: 1887

Human orthology & disease relationships

NCBI Entrez ID: 1737
Ensembl gene IDs: ENSG00000150768
Directly associated (OMIM) disease MIM numbers: 245348
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,175200,203750,231530,231670,245050,245349,248600,266150,266200,300438,312170,606054,606777,607322,609015,609975

Library Location

Plate ID: GDExl11089
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ838239
dbEST ID: 79655941
Trimmed Sequence: ATGCTCCGCCTGTGCCTAAGGTTCCGCGCTCCGGCTCGGTCTGTTTTATCGGGCCGGAGTCAAGCTACGTCAGCGGGTCGGTACCGAAGGCTTCACGTGGGACCTGGGAACCGGCTGAGAGGCTTGGTCGGGTCTCCGGCAAATGTTCCACTGCTAAAGGGAGCTTGGAGACAGGGAACGGCCTCTGGAAAGAGATGGTACAGCCTACCTCCCCACCAGAAGGTGCCTTTGCCTGCCTTGTCTCCCACAATGCAGATGGGAACCATAGCTCGCTGGGAGAAGAAAGAAGGTGATAAAATTAACGAAGGGGATCTAATAGCTGAGGTTGAAACTGACAAGGCCACTGTCGGTTTCGAAAGTCTGGAGGAGGGTTATATGGCTAAAATCCTTGTGGCAGAAGGAACAAGAGATGTGCCCATTGGTTCAGTTATTTGTATTACTGTGGACAAGGCAGAATTTATTGATGCTTTTAAAAATTACACATTGGACTCCGCAGCAGCAGCTTCTCCAAGTGTGGCAGCTGCTACCCCATCACCACCTCCTCAGTCTGCAGTTCAAGCCCCTGGTAGCACTTACCCCAACCATATGACAATTTATCTGCCTGCACTTTCTCCGACCATGACCATGGGTACATTGGAAAAGTGGGAAAAGAAAGATTATAAGAAGGGCGGCAAAGGAAAACCTTGGGGCCGAAATAGAAAAAGAAAAAACAACAAAAAGAATTTAAAATGGCCAAAAGAAAGGTAATTTGAATAAGGATTGTGGGGGCCAAAAAGGCCAAAGAGAAGAAAAAAACCATTTGGGGAACGCGCGGCGGG
Full Trace Sequence: GGGGGGCCATATAATGGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTCCGCCTGTGCCTAAGGTTCCGCGCTCCGGCTCGGTCTGTTTTATCGGGCCGGAGTCAAGCTACGTCAGCGGGTCGGTACCGAAGGCTTCACGTGGGACCTGGGAACCGGCTGAGAGGCTTGGTCGGGTCTCCGGCAAATGTTCCACTGCTAAAGGGAGCTTGGAGACAGGGAACGGCCTCTGGAAAGAGATGGTACAGCCTACCTCCCCACCAGAAGGTGCCTTTGCCTGCCTTGTCTCCCACAATGCAGATGGGAACCATAGCTCGCTGGGAGAAGAAAGAAGGTGATAAAATTAACGAAGGGGATCTAATAGCTGAGGTTGAAACTGACAAGGCCACTGTCGGTTTCGAAAGTCTGGAGGAGGGTTATATGGCTAAAATCCTTGTGGCAGAAGGAACAAGAGATGTGCCCATTGGTTCAGTTATTTGTATTACTGTGGACAAGGCAGAATTTATTGATGCTTTTAAAAATTACACATTGGACTCCGCAGCAGCAGCTTCTCCAAGTGTGGCAGCTGCTACCCCATCACCACCTCCTCAGTCTGCAGTTCAAGCCCCTGGTAGCACTTACCCCAACCATATGACAATTTATCTGCCTGCACTTTCTCCGACCATGACCATGGGTACATTGGAAAAGTGGGAAAAGAAAGATTATAAGAAGGGCGGCAAAGGAAAACCTTGGGGCCGAAATAGAAAAAGAAAAAACAACAAAAAGAATTTAAAATGGCCAAAAGAAAGGTAATTTGAATAAGGATTGTGGGGGCCAAAAAGGCCAAAGAGAAGAAAAAAACCATTTGGGGAACGCGCGGCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCCGCCTGTGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838238
dbEST ID: 79655940
Trimmed Sequence: GAGCAGCATTGTTGTTGGTTTCTCCAAGAATTTTTTGAATTCAGCAAGCCACTGTGCTCCAACTGCCCCGTCCACAACACGGTGATCGCAGCTTAAAGTAACAGACATCACACTGGCAACGTCAAAGCCTTTTTCATTGTCTGCAGGTATCAGTCTATTTTCTGACCCTCCTACAGCAAGGATGCAGGCCTGGGGCGGGTTTATTATGGCAGAGAAGTTTTTGATTCCATACATTCCCAAGTTGGATACAGTGAAGGTTCCACCTTGAAATTCATGAGGTTTAAGCTTGCCTTCTCGTGCCCGGGTTGCTAGAGACAGCACATCTTTGCTGATGGATGCCAGCCCCTTGATGTGGGCATTGAACACAATAGGAGTTATCAGACCAACTGGGGTGCTTACCGCCACACTTACATCAACCACGTGATGCTGTCGAATTACAGTGTCCATCCAGGAGGAGTTTGCTTCTGGGACCTTCAAACATGCCAGAGCTGATGCTTTAATAATGAAGTCATTAAATGACAGTTTAATGTTGTCAGCCTTGGTAACCTCATTGAGTTCTTTTCGCAACTGTGTGATTTCCCCCATGTTTATATCAATGGATAAATAGTAGTGTGGGTATGGTTTGCTTGGAACTGCATGAATCGCTTGAGCGATGAACCCTGCGAAATATTACTAAATGGGGACCATCGGTTGAAAGAACTCAACTTGGGAAACAGCCACCCCACAGCCTGGGAAAATGGGAAAAGCCAAAACTGTCCAGGT
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGCAGCATTGTTGTTGGTTTCTCCAAGAATTTTTTGAATTCAGCAAGCCACTGTGCTCCAACTGCCCCGTCCACAACACGGTGATCGCAGCTTAAAGTAACAGACATCACACTGGCAACGTCAAAGCCTTTTTCATTGTCTGCAGGTATCAGTCTATTTTCTGACCCTCCTACAGCAAGGATGCAGGCCTGGGGCGGGTTTATTATGGCAGAGAAGTTTTTGATTCCATACATTCCCAAGTTGGATACAGTGAAGGTTCCACCTTGAAATTCATGAGGTTTAAGCTTGCCTTCTCGTGCCCGGGTTGCTAGAGACAGCACATCTTTGCTGATGGATGCCAGCCCCTTGATGTGGGCATTGAACACAATAGGAGTTATCAGACCAACTGGGGTGCTTACCGCCACACTTACATCAACCACGTGATGCTGTCGAATTACAGTGTCCATCCAGGAGGAGTTTGCTTCTGGGACCTTCAAACATGCCAGAGCTGATGCTTTAATAATGAAGTCATTAAATGACAGTTTAATGTTGTCAGCCTTGGTAACCTCATTGAGTTCTTTTCGCAACTGTGTGATTTCCCCCATGTTTATATCAATGGATAAATAGTAGTGTGGGTATGGTTTGCTTGGAACTGCATGAATCGCTTGAGCGATGAACCCTGCGAAATATTACTAAATGGGGACCATCGGTTGAAAGAACTCAACTTGGGAAACAGCCACCCCACAGCCTGGGAAAATGGGAAAAGCCAAAACTGTCCAGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCAGCATTGTTGTTGGT