ORFeome > dlc ORF1 – XORFeome v1.0

dlc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dlc
Gene ID: 968501
Gene Page ID: 968496
ORF Xenbase ID: 17272623

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044262
Original XGC clone length: 1929

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11015
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ824212
dbEST ID: 79641914
Trimmed Sequence: ATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCATGCTGCAGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGGCTGTGAGTGACATCCTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCGTGTCCCTTTCCATTTCAAGTGGCCGGGTATTTTCTCCCTTATTATTGAATCTTGGACCACAAACTCAGCTGAACAGTCCACAGAAAACCCTGACAACCTTCTTAGTCGATTGGCTACACGTAGGCGTTTGTCTATTGGGGAGGACTGGTCCCAAGACATACACCTTGGACAGCAGAGTGAGTTGCGTTACTCCTACCATGTCTCTTGTGATGAGCATTATTATGGGGACAGCTGCTCTGATTACTGCAGACCGAGAGATGACAACTTTGGACATTACACTTGTGATGAGCAAGGGAACCGCTTATGCATGTCTGGCTGGAAAGGAGAATATTGCGCTGAACCTATCTGTCTACCTGGTTGCAGTGAGTCTCATGGGTTTTGTGAGCTACCCGGAGAATGTAAATGTCGCATGGGATGGCAAGGAGAACTGTGTGACGAATGTTTACGTTACCCTGGGTGCCAGCATGGATCCTGCTCCCAACCATGGGAGTGCATTTGTTCAGAAAGGCTGGGGAAGGCCTCTTTTGTTACCCGGGACTTGGAACTACCGGTACCAAACAACCCG
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCATGCTGCAGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGGCTGTGAGTGACATCCTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCGTGTCCCTTTCCATTTCAAGTGGCCGGGTATTTTCTCCCTTATTATTGAATCTTGGACCACAAACTCAGCTGAACAGTCCACAGAAAACCCTGACAACCTTCTTAGTCGATTGGCTACACGTAGGCGTTTGTCTATTGGGGAGGACTGGTCCCAAGACATACACCTTGGACAGCAGAGTGAGTTGCGTTACTCCTACCATGTCTCTTGTGATGAGCATTATTATGGGGACAGCTGCTCTGATTACTGCAGACCGAGAGATGACAACTTTGGACATTACACTTGTGATGAGCAAGGGAACCGCTTATGCATGTCTGGCTGGAAAGGAGAATATTGCGCTGAACCTATCTGTCTACCTGGTTGCAGTGAGTCTCATGGGTTTTGTGAGCTACCCGGAGAATGTAAATGTCGCATGGGATGGCAAGGAGAACTGTGTGACGAATGTTTACGTTACCCTGGGTGCCAGCATGGATCCTGCTCCCAACCATGGGAGTGCATTTGTTCAGAAAGGCTGGGGAAGGCCTCTTTTGTTACCCGGGACTTGGAACTACCGGTACCAAACAACCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCACCCCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829521
dbEST ID: 79647223
Trimmed Sequence: 0
Full Trace Sequence: CTGACGGGCAACAGCTATGACCATGTAATACGACTCACTATAAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTCGTTCGTTGCGTCACATTGACAAACACTGCTTTCTTGTGATGCCCACTTTGGACAACATAGTTGGCCAGACCTCGCTGTCTAATATACCTTTGCTCCAGCTTCTGGTAGAATATATATTGGTGTGATTACCTCCATCCTCTGGATACCTTGATGTGCGGATGCACTGACTGGTCTCCGGCTTTCGGCCCTTTGACCGCCCACTTCTCTCCTCCTCACTTTCAGATCCTTGCAGAAGCTTTTGTTTGCTACTTGATTTTTCTCTTAGATAGTCTGGATTAGGCATTTTGAAATGGGGTTCCTTTTCTATCAGGTTATTCTTTGGTTCAAGGTCATTATTGACTCGTCCCTTTTCATTGAAGTGTCCCCTCCTCATACCTCTCATAACCATGAACACTCCACAGCCCAGCAAAAAGAATGTTAGCAGTCCCAGACAAACCACCATGGTAAGAGTGTTTGAGGAGTCAGCACGATGGGAAGCTGGGGTGGGATCATGTACTCTGAATTCACAACTGGTTCCCATAAAACCCGTGGGGCACTGGCATACATTGCCAGTAAAGTGGGTGTAGCAGGTTCCACCATTTTTGCAGGGTTTGGAACTACAGGCATCTACCCGCAGGGTACAGTCTTTGCCCCCATACCCAAGAGTACAGGAGCATGTATAGCTGTTTACTGCATCCACACAAGTACCTCCATTTGCACATGGGCTACTTGCACAGTCATTCATGTTTAGCTCACATCTAGGACCCAGAAAATCCAGGGCGACCCTTGGCACAAAACATTTTCGGGCCCATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACCTCAGTGGCAAATATACAT