ORFeome > dld ORF1 – XORFeome v1.0

dld ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dld
Gene ID: 982854
Gene Page ID: 982850
ORF Xenbase ID: 17272635

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056016
Original XGC clone length: 1530

Human orthology & disease relationships

NCBI Entrez ID: 1738
Ensembl gene IDs: ENSG00000091140
Directly associated (OMIM) disease MIM numbers: 246900
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,115310,150800,171300,175200,203750,210200,231530,231670,243500,245050,245349,248600,251000,252011,256000,266150,266200,268300,300438,312170,601003,605373,605839,606054,606777,606812,607322,609015,609975

Library Location

Plate ID: GDExl11019
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ824658
dbEST ID: 79642360
Trimmed Sequence: ATGTACAGCTGGAGTCGCGTGTACTGCGCATTGAGCCAGAAGAATAACTTTAGCAAAATACCCCATGGCTTGCAAAGAATAAGTTTTGCAGCTTGGAGAAACTATTCAGAGAAAGCAATTGAAGCAGATGTTACGGTCGTTGGTTCTGGTCCAGGAGGCTATGTTGCTGCCATTAAAGCTGCACAGCTGGGTTTCCAGACAGTATGTGTGGAGAAGAATGATACCCTTGGTGGAACTTGTCTGAATGTTGGCTGTATTCCTTCTAAGGCTTTGCTAAACAACTCTCATCTCTATCATTTAGCTCATGGAAAAGATTTTGCGAGCAGAGGAATTGAAGTTACTGGTATCCATTTAAACTTGGAAAAGATGATGGAGCAGAAAAGTGGTGCTGTAAAGTCTCTCACAAGTGGAATTGCTCACTTATTTAAGCAGAACAAGGTAGTACACGTTCAAGGATTTGGAAAGATTACAGGCAAAAATCAAGTAACTGCGACAAAGGCAGATGGCAGTACCCAAGTTGTCAACACTAAGAACATTCTTATTGCAACAGGCTCAGAGGTTGCTCCGTTTCCAGGAATTCCGATTGATGAAGAAACAATTGTATCTTCTACTGGAGCATTGTCTCCTAAGCAAGGCCTGAGAAAATGGTGGTTATGGGTGCTGGTGGTCATTGGGGGTTAAATGGGGCTCCTTATGGCACCGGCCGGGAACGAAGGTTCACCACTTAATTTTTTGGTGGGGGTTGGTGGGGGGGGGGGGTTGTTAGGGGAAATCCCCCAAATTTTTCCCGCCACCCTCTCAAAACGGGGGGGGGAGTTTTAAATTAAACATCAAAAATCC
Full Trace Sequence: AGTTGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACAGCTGGAGTCGCGTGTACTGCGCATTGAGCCAGAAGAATAACTTTAGCAAAATACCCCATGGCTTGCAAAGAATAAGTTTTGCAGCTTGGAGAAACTATTCAGAGAAAGCAATTGAAGCAGATGTTACGGTCGTTGGTTCTGGTCCAGGAGGCTATGTTGCTGCCATTAAAGCTGCACAGCTGGGTTTCCAGACAGTATGTGTGGAGAAGAATGATACCCTTGGTGGAACTTGTCTGAATGTTGGCTGTATTCCTTCTAAGGCTTTGCTAAACAACTCTCATCTCTATCATTTAGCTCATGGAAAAGATTTTGCGAGCAGAGGAATTGAAGTTACTGGTATCCATTTAAACTTGGAAAAGATGATGGAGCAGAAAAGTGGTGCTGTAAAGTCTCTCACAAGTGGAATTGCTCACTTATTTAAGCAGAACAAGGTAGTACACGTTCAAGGATTTGGAAAGATTACAGGCAAAAATCAAGTAACTGCGACAAAGGCAGATGGCAGTACCCAAGTTGTCAACACTAAGAACATTCTTATTGCAACAGGCTCAGAGGTTGCTCCGTTTCCAGGAATTCCGATTGATGAAGAAACAATTGTATCTTCTACTGGAGCATTGTCTCCTAAGCAAGGCCTGAGAAAATGGTGGTTATGGGTGCTGGTGGTCATTGGGGGTTAAATGGGGCTCCTTATGGCACCGGCCGGGAACGAAGGTTCACCACTTAATTTTTTGGTGGGGGTTGGTGGGGGGGGGGGGTTGTTAGGGGAAATCCCCCAAATTTTTCCCGCCACCCTCTCAAAACGGGGGGGGGAGTTTTAAATTAAACATCAAAAATCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACAGCTGGAGTCGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830009
dbEST ID: 79647711
Trimmed Sequence: AAAATTAATAGCTTTGCCAAATGATGCAGCAAGGTTAGCTTCCCTGAAGGCTTCTGATACAGTCGGATGGGCATGGCACACTCTAGCAACATCTTCACAAGAAGCTCCATACTCCATGGCAAGAGCTGCTTCATTAATCATCTCCCCAGCACTTGCTCCAAGAATATGGGCTCCAAGCATTCTGTCTGTAGTTTTATGGCTCAAAATCTTCACCAAGCCATCAGTGTCAGCATTGGTCTTAGCGCGGCTATTTGCAGCAAAAGGAAACTTTCCTACTTTGTACTCTGTACCCTCTTCCTTTAACTGTTCCTCAGACTTTCCAACCCAAGCAACTTCAGGGTGTGTGTAGATCACTGAGGGAACACAGTTGTAGTCAATGTGAACTGCTCCTCCTGCCATTCCCTCAACGCAGATAATGCCTTCATCTTCTGCTTTATGAGCCAACATTGGTCCAGCCACTACATCACCAATTGCATAAATATTTGGTATTTTTGTTTGAAAACGACTATTAATTGGAATCCTTCCTCTGTTGTCTAGTTCAATTCCTAATTCTTGCAACCCAAGGTTTTCTGTGAATGGACGTCGACCAATACACACAAGCAGTACATCACAAGTAATAACTTCTTCTTTTCCCGCAGCTGCTGCTTCTATAGAAACATCAATCTTCCCATCTGGTCTCTTGGCTTGCCCCCAATGACTTTTTGTGCCTAAATTTTAACTTTCAGTCCCCGGTTTTTTAAGGGAAACGGGGGGAAAATTTTTTTGAAAAA
Full Trace Sequence: GGACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAATTAATAGCTTTGCCAAATGATGCAGCAAGGTTAGCTTCCCTGAAGGCTTCTGATACAGTCGGATGGGCATGGCACACTCTAGCAACATCTTCACAAGAAGCTCCATACTCCATGGCAAGAGCTGCTTCATTAATCATCTCCCCAGCACTTGCTCCAAGAATATGGGCTCCAAGCATTCTGTCTGTAGTTTTATGGCTCAAAATCTTCACCAAGCCATCAGTGTCAGCATTGGTCTTAGCGCGGCTATTTGCAGCAAAAGGAAACTTTCCTACTTTGTACTCTGTACCCTCTTCCTTTAACTGTTCCTCAGACTTTCCAACCCAAGCAACTTCAGGGTGTGTGTAGATCACTGAGGGAACACAGTTGTAGTCAATGTGAACTGCTCCTCCTGCCATTCCCTCAACGCAGATAATGCCTTCATCTTCTGCTTTATGAGCCAACATTGGTCCAGCCACTACATCACCAATTGCATAAATATTTGGTATTTTTGTTTGAAAACGACTATTAATTGGAATCCTTCCTCTGTTGTCTAGTTCAATTCCTAATTCTTGCAACCCAAGGTTTTCTGTGAATGGACGTCGACCAATACACACAAGCAGTACATCACAAGTAATAACTTCTTCTTTTCCCGCAGCTGCTGCTTCTATAGAAACATCAATCTTCCCATCTGGTCTCTTGGCTTGCCCCCAATGACTTTTTGTGCCTAAATTTTAACTTTCAGTCCCCGGTTTTTTAAGGGAAACGGGGGGAAAATTTTTTTGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAATTAATAGCTTTGCCAAATGA