ORFeome > dlx3 ORF2 – XORFeome v1.0

dlx3 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dlx3
Gene ID: 5879348
Gene Page ID: 5879292
ORF Xenbase ID: 17272647

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123268
Original XGC clone length: 834

Human orthology & disease relationships

NCBI Entrez ID: 1747
Ensembl gene IDs: ENSG00000064195
Directly associated (OMIM) disease MIM numbers: 104510,190320
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ838853
dbEST ID: 79656555
Trimmed Sequence: ATGAGTGGCCCCTATGAGAAGAAGATGGCCGTGTTGACCGACCTGAGCACCTCGTCCCACCCTGTGACCAAGGACTCGCCCACCCTGCCCGAGTCCAGTGCCACAGATATGGGCTACTATAATGGCCACCTCTCTACTGGGCAGCACGACTTCTTCCAGACTCAGGCTTACTCCCCAACCATCAGCTCCTACGGCTACCCCCACCCTCCCCATCCTCAGTACAACTTTAATGGGCTTGTGGGCAACGAGAGCTTCTTGCCCAAGGACGACTACCAGTATGGCTATCGGCCGTTTGTCCATTACAGAGAACCCCCAGTGCAGGAGACAGTATCAGTGAAGGAAGAGCCCGAAACCGAAGTCCGGATGGTTAATGGGAAACCTAAAAAGATCCGGAAGCCAAGAACCATCTACTCTAGTTACCAGCTGGCCGCTTTGCAGAGAAGGTTCCAGAAGGCCCAGTATTTGGCACTGCCCGAGAGAGCAGAACTGGCCGCCCAGTTAGGACTCACTCAGACGCAGGTTAAAATCTGGTTCCAGAACCGAAGATCTAAGTTTAAAAAACTCTACAAAAACCGGAGAAGGTCCTGATATGGAGCACAGTTCCAAATAATAGTGACTCCCTGGCCTTGCAGTTCCCCTTCCTCTCCACCCCTATTGGCACAATATTGGAAGCCCGAACCCCTTCTGCAGCCACCACCGCAGCAGCCAAAGTCTTCCACAATGGCCCCTCCCCGTCCCTAATCTGGGAAAACTAACCAATCTTGGGTAAACTCCCACCAAGAACCCAATTCCTGGGGCAAACCTTCTGACGGACCGT
Full Trace Sequence: CTCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGGCCCCTATGAGAAGAAGATGGCCGTGTTGACCGACCTGAGCACCTCGTCCCACCCTGTGACCAAGGACTCGCCCACCCTGCCCGAGTCCAGTGCCACAGATATGGGCTACTATAATGGCCACCTCTCTACTGGGCAGCACGACTTCTTCCAGACTCAGGCTTACTCCCCAACCATCAGCTCCTACGGCTACCCCCACCCTCCCCATCCTCAGTACAACTTTAATGGGCTTGTGGGCAACGAGAGCTTCTTGCCCAAGGACGACTACCAGTATGGCTATCGGCCGTTTGTCCATTACAGAGAACCCCCAGTGCAGGAGACAGTATCAGTGAAGGAAGAGCCCGAAACCGAAGTCCGGATGGTTAATGGGAAACCTAAAAAGATCCGGAAGCCAAGAACCATCTACTCTAGTTACCAGCTGGCCGCTTTGCAGAGAAGGTTCCAGAAGGCCCAGTATTTGGCACTGCCCGAGAGAGCAGAACTGGCCGCCCAGTTAGGACTCACTCAGACGCAGGTTAAAATCTGGTTCCAGAACCGAAGATCTAAGTTTAAAAAACTCTACAAAAACCGGAGAAGGTCCTGATATGGAGCACAGTTCCAAATAATAGTGACTCCCTGGCCTTGCAGTTCCCCTTCCTCTCCACCCCTATTGGCACAATATTGGAAGCCCGAACCCCTTCTGCAGCCACCACCGCAGCAGCCAAAGTCTTCCACAATGGCCCCTCCCCGTCCCTAATCTGGGAAAACTAACCAATCTTGGGTAAACTCCCACCAAGAACCCAATTCCTGGGGCAAACCTTCTGACGGACCGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGGCCCCTATGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838852
dbEST ID: 79656554
Trimmed Sequence: ATACACTGTATCGGGAGGAGGTTGGTGCATAACTTCAGAAGGTTGTAGATGTTGCCCAGATTGGTTCTGTTGAGTGTACCATGAATGGTAGTTCTCCAGATAGGAGGGGGAGGAGCATTGTGGAAGACTTTGCTGCTGCTGTTGCTGCTGCAGAGGGGTTCGGCTTCCACTATTGTCCCATATGGGTGGAGATGAAGGGGAATTGCAAGCCATGGAGTCACTATTATTTGGACTGTGCTCCATATCAGGACCTTCTCCGTTTTTGTAGAGTTTTTTAAACTTAGATCTTCGGTTCTGGAACCAGATTTTTACCTGCGTCTGAGTGAGTCCTAACTGGGCGGCCAGTTCTGCTCTCTCTCGCAGTGCCAAATACTGAGCCTTCTCGAACCGTCTCTGCGGAGCGGCCAGCTGGTAACTAGAGTAGATGGATCTTGGCTTCGGCATCTTTTTATGTTTCGCGGTTAACCATCCAGACTACAGATTTCGGGCCCTTCGTTCTCTGATACTGTCAACCGCGACTGGGGGTTCGGGGGAGGGGGCAGAGGGGGGGATAGGCATAACTTCTAAATGGGGTTTGGGGGGTGGGGGCTCCTTCCCCACCACGCCCCCAAAAGCTATAATAGTGTGAGAGAGAGGGGGGGGGGGGGGGGGGGGGGGGGGCCGGGCTGAGACAACGAGGGGGCGGGCCCCCAAAAGCAGGGGGAAGAAAAAATCTCGCCCGGGCGGAAAAAAAGAGAAGAGCGAGGCAAGGGGGGGTTTCCTTAAGGGAGAGGGGAAGAAACAATG
Full Trace Sequence: AGCCAGTGGTAATACCGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATACACTGTATCGGGAGGAGGTTGGTGCATAACTTCAGAAGGTTGTAGATGTTGCCCAGATTGGTTCTGTTGAGTGTACCATGAATGGTAGTTCTCCAGATAGGAGGGGGAGGAGCATTGTGGAAGACTTTGCTGCTGCTGTTGCTGCTGCAGAGGGGTTCGGCTTCCACTATTGTCCCATATGGGTGGAGATGAAGGGGAATTGCAAGCCATGGAGTCACTATTATTTGGACTGTGCTCCATATCAGGACCTTCTCCGTTTTTGTAGAGTTTTTTAAACTTAGATCTTCGGTTCTGGAACCAGATTTTTACCTGCGTCTGAGTGAGTCCTAACTGGGCGGCCAGTTCTGCTCTCTCTCGCAGTGCCAAATACTGAGCCTTCTCGAACCGTCTCTGCGGAGCGGCCAGCTGGTAACTAGAGTAGATGGATCTTGGCTTCGGCATCTTTTTATGTTTCGCGGTTAACCATCCAGACTACAGATTTCGGGCCCTTCGTTCTCTGATACTGTCAACCGCGACTGGGGGTTCGGGGGAGGGGGCAGAGGGGGGGATAGGCATAACTTCTAAATGGGGTTTGGGGGGTGGGGGCTCCTTCCCCACCACGCCCCCAAAAGCTATAATAGTGTGAGAGAGAGGGGGGGGGGGGGGGGGGGGGGGGGGCCGGGCTGAGACAACGAGGGGGCGGGCCCCCAAAAGCAGGGGGAAGAAAAAATCTCGCCCGGGCGGAAAAAAAGAGAAGAGCGAGGCAAGGGGGGGTTTCCTTAAGGGAGAGGGGAAGAAACAATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATACACTGTATCGGGAGGAGGTT