ORFeome > dnaja3 ORF1 – XORFeome v1.0

dnaja3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dnaja3
Gene ID: 6254987
Gene Page ID: 5718162
ORF Xenbase ID: 17272743

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129676
Original XGC clone length: 1374

Human orthology & disease relationships

NCBI Entrez ID: 9093
Ensembl gene IDs: ENSG00000103423
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 173100,209950,219050,262400,262650,266600,274500,600802,601665,607785,608354,608355,609135

Library Location

Plate ID: GDExl11091
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ838697
dbEST ID: 79656399
Trimmed Sequence: ATGGCGGCTCGCTGTTCGTCGCGTTGGTTCTTGGTCGCAGTGTCTGGAGCTCGGGGCCACATCCTTCCCGGTGTCCATCGGGGGCCCAGGGCTGAGGCAGCTTTGGTATTGGCCTTGCGGGCGGCCCGTGGCCCAGCTGCAGTCCTGTGTGAGCGCCTTTCCCAGTTCCATACCACCTCTTCCTCATACAACAAGACAGACTTTTACCAGGTACTGGGGGTTCCGAGGAACGCAAGCCAGAAAGAAATAAAGAAGGCCTATTACCAGTTGGCCAAAAAGTACCATCCAGACACTAATAAGGAGGATCCGCAGGCTAAAGAAAAGTTCTCTCAGCTGGCAGAAGCATACGAGGTCCTGAGTGACGAGGTCAAACGCAAGCAGTATGACACCTATGGAACTGCAGACTTTGCTGCCGGGGCAGGAGGCGGAGGAGGTCAGCAACGCTGGAGAGGAGGTCCTACTGTCGATCCAGAGGAACTCTTCCGGAAGATCTTTGGGGAATTCTCTGGCTCCCCGTTTGGAGATTTATGTAGCATGTTTGAGCAGCCACAAGAGTACATCATGGACCTCACGTTCATTCAGGCCGCTAAGGGAATGAACAAGGAAGATCTCTGTAAACATTACAAACACGTGGCACAGGTTTGAATGGGAAAGGAAATGAACCTGGCACCAAAACCTCCAACACTGCCATTAACTGTTATGGGAACTGGGGAGGGAAACAAACAACACACTGGCCCCCTTTTTGTGA
Full Trace Sequence: TCGTGGCACAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCGCTGTTCGTCGCGTTGGTTCTTGGTCGCAGTGTCTGGAGCTCGGGGCCACATCCTTCCCGGTGTCCATCGGGGGCCCAGGGCTGAGGCAGCTTTGGTATTGGCCTTGCGGGCGGCCCGTGGCCCAGCTGCAGTCCTGTGTGAGCGCCTTTCCCAGTTCCATACCACCTCTTCCTCATACAACAAGACAGACTTTTACCAGGTACTGGGGGTTCCGAGGAACGCAAGCCAGAAAGAAATAAAGAAGGCCTATTACCAGTTGGCCAAAAAGTACCATCCAGACACTAATAAGGAGGATCCGCAGGCTAAAGAAAAGTTCTCTCAGCTGGCAGAAGCATACGAGGTCCTGAGTGACGAGGTCAAACGCAAGCAGTATGACACCTATGGAACTGCAGACTTTGCTGCCGGGGCAGGAGGCGGAGGAGGTCAGCAACGCTGGAGAGGAGGTCCTACTGTCGATCCAGAGGAACTCTTCCGGAAGATCTTTGGGGAATTCTCTGGCTCCCCGTTTGGAGATTTATGTAGCATGTTTGAGCAGCCACAAGAGTACATCATGGACCTCACGTTCATTCAGGCCGCTAAGGGAATGAACAAGGAAGATCTCTGTAAACATTACAAACACGTGGCACAGGTTTGAATGGGAAAGGAAATGAACCTGGCACCAAAACCTCCAACACTGCCATTAACTGTTATGGGAACTGGGGAGGGAAACAAACAACACACTGGCCCCCTTTTTGTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCGCTGTTCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838696
dbEST ID: 79656398
Trimmed Sequence: GGAGCTAAACATTCTCTTTAGTTTGCTTAGGAATCCCTCCTTGTTCTCCCCTGCCTGCTCAGTCTCAGGTCTCTCCTCCCCAGCTGCAGAGCTGGGCTGGTTTCTGCCTGTTGTTGTGTTAGTGATGCCATTTACTGTTCCTTCTACATCTGTCTCATCCTCTGCAAAGCTAAGCATTAGCATTCGTTGCCTGTCAGTCAGATGCCTGGGTACTTTGACCTTGACGTGGATATAATGATCTCCAAAGCCATAACTGCTCATACGAGCAATACCTTTTCCACCAATCCGAATCCTCTGGTCTGCTTGTGTGCCGGCAGGGATAGGGACATTGATGGGTTCATATAGTCCTTGTGCACGGGCAGAACCCCCCAGAACAGCTTGAGCAACGGAAATAAACAGGTCCGAGTGAATATCTGCCCCATCTCTTCTAAAGACTGGACTTTTCTGCACCCGAAATGTAATAAAAATCTCTTTCTTTCCCACTGGCATCCGAACCGTCTGCCCATTTTCCACACCTGCAGGTACAGGCACAGTAACAGTTTTCTTCTGCTTTGTTTGGCCAGAGCCCCTGCATGACAGGCAAGGGTTGGTCATGGGAAAACCCTTTCCCCCCACGCGCCCGCAAATCGAGCGCATCACAAAGGGGCCCGTGTTGATAGTTTTCATCCCATTTCCATTACGGTTAGGGCAAGTGCTGCGGGTTTGGTGCCCGGGCCGCATTTTCCTTTTCCCATCCCCCCCCTGT
Full Trace Sequence: GGGAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGCTAAACATTCTCTTTAGTTTGCTTAGGAATCCCTCCTTGTTCTCCCCTGCCTGCTCAGTCTCAGGTCTCTCCTCCCCAGCTGCAGAGCTGGGCTGGTTTCTGCCTGTTGTTGTGTTAGTGATGCCATTTACTGTTCCTTCTACATCTGTCTCATCCTCTGCAAAGCTAAGCATTAGCATTCGTTGCCTGTCAGTCAGATGCCTGGGTACTTTGACCTTGACGTGGATATAATGATCTCCAAAGCCATAACTGCTCATACGAGCAATACCTTTTCCACCAATCCGAATCCTCTGGTCTGCTTGTGTGCCGGCAGGGATAGGGACATTGATGGGTTCATATAGTCCTTGTGCACGGGCAGAACCCCCCAGAACAGCTTGAGCAACGGAAATAAACAGGTCCGAGTGAATATCTGCCCCATCTCTTCTAAAGACTGGACTTTTCTGCACCCGAAATGTAATAAAAATCTCTTTCTTTCCCACTGGCATCCGAACCGTCTGCCCATTTTCCACACCTGCAGGTACAGGCACAGTAACAGTTTTCTTCTGCTTTGTTTGGCCAGAGCCCCTGCATGACAGGCAAGGGTTGGTCATGGGAAAACCCTTTCCCCCCACGCGCCCGCAAATCGAGCGCATCACAAAGGGGCCCGTGTTGATAGTTTTCATCCCATTTCCATTACGGTTAGGGCAAGTGCTGCGGGTTTGGTGCCCGGGCCGCATTTTCCTTTTCCCATCCCCCCCCTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGCTAAACATTCTCTTTAGTTT