ORFeome > dnaja4.1 ORF1 – XORFeome v1.0

dnaja4.1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dnaja4.1
Gene ID: 1001748
Gene Page ID: 1001742
ORF Xenbase ID: 17272749

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054199
Original XGC clone length: 1194

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ839359
dbEST ID: 79657061
Trimmed Sequence: ATGGTGAAGGAGACAGCATACTATGATACCCTTGGGGTGAAGCCCAATGCCACTCCAGATGAGATTAAAAAGGCTTACAGGAAGCTGGCACTGAAATATCACCCTGATAAGAACCCCAATGAAGGAGAAAAGTTTAAGCAAATCTCTCAAGCATATGATGTGCTATCGGATTCCAAAAAAAGGGACCTCTATGATCAGGGTGGAGAACAGGCCATTAAAGAAGGAGGAATGGGAGGAGGACCCTTTTCTTTCCCTACGGACATCTTTGACATGTTCTTTGGTGGAGGTGGCCGCATGAACAGAGAGAAGAGAGGTAAAAATGTAGTTCATCAGTTGTCTGTATCTTTAAACGATCTGTACAATGGCACTAGCAGGAAACTGGCTCTACAGAAGAACGTAATCTGTGGCAAGTGTGAAGGTCGCGGTGGTAAGAAAGGAGTAGTAGAGAAGTGTACAACATGTAAGGGCCGTGGTGTTCAAGTGCGTATACATCAAATTGGACCTGGCATGGTTCAGCAGATACAGTCCATGTGCTCCGACTGCCGTGGAGAGGGTGAACGCATTAACCCAAAAGACCGCTGCNAACAGTGCTCTGGAAAACAGGTTACCCGTGAAAAGAAGATTCTGGAGATACATGTTGATAAAGGCCTGAAAGATGGACAAAAAATTGTGTTCAATGGGAAAAGGTGATCAAGAACCAGGGTTTGAAGGCTGGAAGAATTGGGGGAAAATTTTTTGCACCAAAAAAAAACAATAATTTATTAATAAAAAAGCAAAAACCACCCAACCTGAAATTAAAAAAAAATGGAAAATTTAAA
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAAGGAGACAGCATACTATGATACCCTTGGGGTGAAGCCCAATGCCACTCCAGATGAGATTAAAAAGGCTTACAGGAAGCTGGCACTGAAATATCACCCTGATAAGAACCCCAATGAAGGAGAAAAGTTTAAGCAAATCTCTCAAGCATATGATGTGCTATCGGATTCCAAAAAAAGGGACCTCTATGATCAGGGTGGAGAACAGGCCATTAAAGAAGGAGGAATGGGAGGAGGACCCTTTTCTTTCCCTACGGACATCTTTGACATGTTCTTTGGTGGAGGTGGCCGCATGAACAGAGAGAAGAGAGGTAAAAATGTAGTTCATCAGTTGTCTGTATCTTTAAACGATCTGTACAATGGCACTAGCAGGAAACTGGCTCTACAGAAGAACGTAATCTGTGGCAAGTGTGAAGGTCGCGGTGGTAAGAAAGGAGTAGTAGAGAAGTGTACAACATGTAAGGGCCGTGGTGTTCAAGTGCGTATACATCAAATTGGACCTGGCATGGTTCAGCAGATACAGTCCATGTGCTCCGACTGCCGTGGAGAGGGTGAACGCATTAACCCAAAAGACCGCTGCNAACAGTGCTCTGGAAAACAGGTTACCCGTGAAAAGAAGATTCTGGAGATACATGTTGATAAAGGCCTGAAAGATGGACAAAAAATTGTGTTCAATGGGAAAAGGTGATCAAGAACCAGGGTTTGAAGGCTGGAAGAATTGGGGGAAAATTTTTTGCACCAAAAAAAAACAATAATTTATTAATAAAAAAGCAAAAACCACCCAACCTGAAATTAAAAAAAAATGGAAAATTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAAGGAGACAGCATA

Sequences - 3ʹ (reverse) EST

Accession: JZ839358
dbEST ID: 79657060
Trimmed Sequence: GGAGGTTTGGCATTGAACTCCACTCCTGGGACTCTCGTCTTCTTGGTATGCCTCTCCCCTGTACTTCCTGTTCTGCTCCTGCTCATCAAATTCCACAAGCTCCACAACTTCCATATCATCACTGACCATTTCTTCTTCTTCTCTTGGTGGAAGCAAGGCCTCTAGAAGACGGAACTTTTCAACAGCAAGCCACTGATTGTCAGGGAAAGTAACTGTAAAGTGAATAATTAAGAGGCCCTTTTCAAATGGGTCCCTCTGCAAGGGCATGCCCTCATTTCGAATGCTCTTTACTTGCCCATGCTTTATCACTTCACCTGGATAAGAGGTGACCAGGAGAACTCTGCCATCCATTGTCTCAATAGGCTTTTTAAAGCCACACAAAGCTTCTACTAATTTAATTTCCATTTTCATAATCAGGTCGTTGTCTTGCCTTTGATAGATATCATGTTCTTTTTGGTCCAAAACTATCACCACATCTCCAGCCTCCAACCCTGGTTCTTGATCACCTTCTCCATTGAACACAATTTTTTGTCCATCTTTCATGCCTTTATCAACATGTATCTCCAGAATCTTCTTTTCACGGGTAACCTTGTTTCCAGAGCACTGTTTGCAGCGGTCTTTTGGGGTTAATGCGTTCACCCTCTCCACGGCAGTCGGAGCACATGGACTGTATCTGCTGAACCATGCCCGGGTCAAATTTGATTGTAAACGCACTTTGAACACCAGGGCCCCTTAAATGTTGGTACACTTTCCTCACCAACTCCCTTTTTTA
Full Trace Sequence: ACGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGGTTTGGCATTGAACTCCACTCCTGGGACTCTCGTCTTCTTGGTATGCCTCTCCCCTGTACTTCCTGTTCTGCTCCTGCTCATCAAATTCCACAAGCTCCACAACTTCCATATCATCACTGACCATTTCTTCTTCTTCTCTTGGTGGAAGCAAGGCCTCTAGAAGACGGAACTTTTCAACAGCAAGCCACTGATTGTCAGGGAAAGTAACTGTAAAGTGAATAATTAAGAGGCCCTTTTCAAATGGGTCCCTCTGCAAGGGCATGCCCTCATTTCGAATGCTCTTTACTTGCCCATGCTTTATCACTTCACCTGGATAAGAGGTGACCAGGAGAACTCTGCCATCCATTGTCTCAATAGGCTTTTTAAAGCCACACAAAGCTTCTACTAATTTAATTTCCATTTTCATAATCAGGTCGTTGTCTTGCCTTTGATAGATATCATGTTCTTTTTGGTCCAAAACTATCACCACATCTCCAGCCTCCAACCCTGGTTCTTGATCACCTTCTCCATTGAACACAATTTTTTGTCCATCTTTCATGCCTTTATCAACATGTATCTCCAGAATCTTCTTTTCACGGGTAACCTTGTTTCCAGAGCACTGTTTGCAGCGGTCTTTTGGGGTTAATGCGTTCACCCTCTCCACGGCAGTCGGAGCACATGGACTGTATCTGCTGAACCATGCCCGGGTCAAATTTGATTGTAAACGCACTTTGAACACCAGGGCCCCTTAAATGTTGGTACACTTTCCTCACCAACTCCCTTTTTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGTTTGGCATTGAACT