ORFeome > dnajb9 ORF1 – XORFeome v1.0

dnajb9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dnajb9
Gene ID: 6253609
Gene Page ID: 493655
ORF Xenbase ID: 17272815

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046936
Original XGC clone length: 666

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ824289
dbEST ID: 79641991
Trimmed Sequence: ATGGCATCAGCACAGTCAGTCCTCACATTTGCCGTTTGTATTTTGCTGATATCAGAAATAATACTGGCAAAAAAGACTTATTATGACATTTTGGGAGTTCCAAAAAATGCCTCTGAGCGACAGATCAAAAAAGCTTTTCACAAACTTGCAATGAAATATCATCCTGACAAGAATAAAAGCCCTGATGCTGAGACAAAATTTCGAGAAATCGCTGAAGCTTATGAGACTCTATCAGATGAAAGTAAACGGAAGGAGTATGATCAGTTTGGTCATGATGCCTTTGCGAATGGTGGAGGAGGTGGCAGTGACCAACATTTCCACAAACATTTTAACTTCAACTTTGATGATTTATTTAAAGACTTCGACATTTTTGGTGAAAGCCAAAATAGTAGATCTAAAAGGCACTTTCAAAACCATTTCAGAAGCCATCAAGAGGCTCATAACAGACATAGACAACACTTTGAGGACTTTTCTTTTGGAGGAGGACTGTTCAATGACATGTTTGAGGATATGGAAAAAATGTTTACATTTGGTGGTTTTGATGGCACTCGTAGAAATCCTATGAGGGCAGAAAGCGGATTTCAAGGATCTAGCAAGCACTGTAGAACTGTCACTCAAAGGAGAGGAAACATGGTTACAACATATACAGATTGTTCAGGGCAGTT
Full Trace Sequence: GCAATAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATCAGCACAGTCAGTCCTCACATTTGCCGTTTGTATTTTGCTGATATCAGAAATAATACTGGCAAAAAAGACTTATTATGACATTTTGGGAGTTCCAAAAAATGCCTCTGAGCGACAGATCAAAAAAGCTTTTCACAAACTTGCAATGAAATATCATCCTGACAAGAATAAAAGCCCTGATGCTGAGACAAAATTTCGAGAAATCGCTGAAGCTTATGAGACTCTATCAGATGAAAGTAAACGGAAGGAGTATGATCAGTTTGGTCATGATGCCTTTGCGAATGGTGGAGGAGGTGGCAGTGACCAACATTTCCACAAACATTTTAACTTCAACTTTGATGATTTATTTAAAGACTTCGACATTTTTGGTGAAAGCCAAAATAGTAGATCTAAAAGGCACTTTCAAAACCATTTCAGAAGCCATCAAGAGGCTCATAACAGACATAGACAACACTTTGAGGACTTTTCTTTTGGAGGAGGACTGTTCAATGACATGTTTGAGGATATGGAAAAAATGTTTACATTTGGTGGTTTTGATGGCACTCGTAGAAATCCTATGAGGGCAGAAAGCGGATTTCAAGGATCTAGCAAGCACTGTAGAACTGTCACTCAAAGGAGAGGAAACATGGTTACAACATATACAGATTGTTCAGGGCAGTTGCCAACTTTCTTGTACAAAGTTGGCATTTATAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCCAATCCGGCTGAAATCCCCCCTATAGTGAAGTCATAATAAAAAAAGAAACAATAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCAGCACAGTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829629
dbEST ID: 79647331
Trimmed Sequence: CTGCCCTGAACAATCTGTATATGTTGTAACCATGTTTCCTCTCCTTTGAATGACAGTTCTACAGTGCTTGCTAGATCCTTGAAATCCGCTTTCTGCCCTCATAGGATTTCTACGAGTGCCATCAAAACCACCAAATGTAAACATTTTTTCCATATCCTCAAACATGTCATTGAACAGTCCTCCTCCAAAAGAAAAGTCCTCAAAGTGTTGTCTATGTCTGTTATGAGCCTCTTGATGGCTTCTGAAATGGTTTTGAAAGTGCCTTTTAGATCTACTATTTTGGCTTTCACCAAAAATGTCGAAGTCTTTAAATAAATCATCAAAGTTGAAGTTAAAATGTTTGTGGAAATGTTGGTCACTGCCACCTCCTCCACCATTCGCAAAGGCATCATGACCAAACTGATCATACTCCTTCCGTTTACTTTCATCTGATAGAGTCTCATAAGCTTCAGCGATTTCTCGAAATTTTGTCTCAGCATCAGGGCTTTTATTCTTGTCANGATGATATTTCATTGCAAGTTTGTGAAAAGCTTTTTTGATCTGTCGCTCAGAGGCATTTTTTGGAACTCCCAAATGTCATAATAAGTCTTTTTTGCCCGTATTATTTCTGATATCAGCAAAATACAAACGGCAAATGTGAGGACTGACTGTGCTGATGCCATGGTGCCACTTTTTTTGGTAAAAATTTGGATTATTAAAAAAACATTTGTTAAAAAAATTTTTTGAAACCCAAAAAGGGTCCAAAATAAATTAAAAAAAA
Full Trace Sequence: CTGCCCGGGTAGAGCCATCGAGATTGGAAGACGAACCACTAAAGGGGGAGATCAGCTGGAAGGCAAAAAGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCCCTGAACAATCTGTATATGTTGTAACCATGTTTCCTCTCCTTTGAATGACAGTTCTACAGTGCTTGCTAGATCCTTGAAATCCGCTTTCTGCCCTCATAGGATTTCTACGAGTGCCATCAAAACCACCAAATGTAAACATTTTTTCCATATCCTCAAACATGTCATTGAACAGTCCTCCTCCAAAAGAAAAGTCCTCAAAGTGTTGTCTATGTCTGTTATGAGCCTCTTGATGGCTTCTGAAATGGTTTTGAAAGTGCCTTTTAGATCTACTATTTTGGCTTTCACCAAAAATGTCGAAGTCTTTAAATAAATCATCAAAGTTGAAGTTAAAATGTTTGTGGAAATGTTGGTCACTGCCACCTCCTCCACCATTCGCAAAGGCATCATGACCAAACTGATCATACTCCTTCCGTTTACTTTCATCTGATAGAGTCTCATAAGCTTCAGCGATTTCTCGAAATTTTGTCTCAGCATCAGGGCTTTTATTCTTGTCANGATGATATTTCATTGCAAGTTTGTGAAAAGCTTTTTTGATCTGTCGCTCAGAGGCATTTTTTGGAACTCCCAAATGTCATAATAAGTCTTTTTTGCCCGTATTATTTCTGATATCAGCAAAATACAAACGGCAAATGTGAGGACTGACTGTGCTGATGCCATGGTGCCACTTTTTTTGGTAAAAATTTGGATTATTAAAAAAACATTTGTTAAAAAAATTTTTTGAAACCCAAAAAGGGTCCAAAATAAATTAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCCCTGAACAATCTGTA