ORFeome > dnajc8 ORF1 – XORFeome v1.0

dnajc8 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dnajc8
Gene ID: 946549
Gene Page ID: 946545
ORF Xenbase ID: 17272875

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078484
Original XGC clone length: 753

Human orthology & disease relationships

NCBI Entrez ID: 22826
Ensembl gene IDs: ENSG00000126698
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11004
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ839732
dbEST ID: 79657434
Trimmed Sequence: ATGGCGGCTCCCGGGTCTGGCGGTCCGTCCGGTTCAGTGGATGATGCTTTCTCGACGTATTACACAGAGGTTAAGCAAATTGAAAAACGTGATTCTGTCTTAACCCCAAAGCAGCAAATCGAAAGACTGATTAGACCTGGATCGTCCTACTTTAACTTAAACCCTTTCGAGGTCCTGCAAATTGATCCAGAAGCAACAGATGAGGAAGTCAAGAAGAGATTTCGCCAGTTATCGATTCTTGTTCATCCGGATAAAAATCAAGATGATCCAGAAAGAGCCCAGAAAGCTTTTGAAGCTGTAGACAAAGCCTATAAAGGTCTCCTGGAACCAGAGCAGAAAAAGAGGGCTATTGATGTCATCCAAGCTGGACAGGAATATGTTGAACATATTGTAAAAGAAAAAAAGAAGCAGTTGAAAAAGGAAGGAAAATCATTAACAGTTGAAGAAGATGACCCTGAAGTGTTCAAACAGGCTGTGTACAAACAGACGATGAAGCTCTTTGCAGAGCTGGAAATCAAACGTAAAGAGAGAGAAGCAAAAGATATGCATGAAAGAAAGAGGCAGAGAGAAGAGGAAATAGAAACTCAAGAAAAAGCCAAAAGGGAAAGAGAGTGGCAGAAAAACTTTGAGGAAAGTCGAGATGGGCGAGTGGATAGCTGGCGGAGCTTCCAATCGCACAAAAAAGGAAAAAAAGAAAAAAAAAGCAGGGACCTTTTTTAAACCACCAAAAATGGAGATGGGAACCAAAGAAAGTTGCCCACTTTTCTTGGTAACAAGTTTGGCATTTAAAAAAAAACAATTGCTTTAATAATTTTTTTTGGCA
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCCCGGGTCTGGCGGTCCGTCCGGTTCAGTGGATGATGCTTTCTCGACGTATTACACAGAGGTTAAGCAAATTGAAAAACGTGATTCTGTCTTAACCCCAAAGCAGCAAATCGAAAGACTGATTAGACCTGGATCGTCCTACTTTAACTTAAACCCTTTCGAGGTCCTGCAAATTGATCCAGAAGCAACAGATGAGGAAGTCAAGAAGAGATTTCGCCAGTTATCGATTCTTGTTCATCCGGATAAAAATCAAGATGATCCAGAAAGAGCCCAGAAAGCTTTTGAAGCTGTAGACAAAGCCTATAAAGGTCTCCTGGAACCAGAGCAGAAAAAGAGGGCTATTGATGTCATCCAAGCTGGACAGGAATATGTTGAACATATTGTAAAAGAAAAAAAGAAGCAGTTGAAAAAGGAAGGAAAATCATTAACAGTTGAAGAAGATGACCCTGAAGTGTTCAAACAGGCTGTGTACAAACAGACGATGAAGCTCTTTGCAGAGCTGGAAATCAAACGTAAAGAGAGAGAAGCAAAAGATATGCATGAAAGAAAGAGGCAGAGAGAAGAGGAAATAGAAACTCAAGAAAAAGCCAAAAGGGAAAGAGAGTGGCAGAAAAACTTTGAGGAAAGTCGAGATGGGCGAGTGGATAGCTGGCGGAGCTTCCAATCGCACAAAAAAGGAAAAAAAGAAAAAAAAAGCAGGGACCTTTTTTAAACCACCAAAAATGGAGATGGGAACCAAAGAAAGTTGCCCACTTTTCTTGGTAACAAGTTTGGCATTTAAAAAAAAACAATTGCTTTAATAATTTTTTTTGGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCCCGGGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839731
dbEST ID: 79657433
Trimmed Sequence: CTCTCTTTGCTCCATCTTCACTTTTGGTGGTTTTAAAAAGGTCCTTGCCTTCTTTTCTTTTTTTCCTTTTTTGTGCGATTGGAAGCTTCGCCAGCTATCCACTCGCCCATCTCGACTTTCCTCAAAGTTTTTCTGCCACTCTCTTTCCCTTTTGGCTTTTTCTTGAGTTTCTATTTCCTCTTCTCTCTGCCTCTTTCTTTCATGCATATCTTTTGCTTCTCTCTCTTTACGTTTGATTTCCAGCTCTGCAAAGAGCTTCATCGTCTGTTTGTACACAGCCTGTTTGAACACTTCAGGGTCATCTTCTTCAACTGTTAATGATTTTCCTTCCTTTTTCAACTGCTTCTTTTTTTCTTTTACAATATGTTCAACATATTCCTGTCCAGCTTGGATGACATCAATAGCCCTCTTTTTCTGCTCTGGTTCCAGGAGACCTTTATAGGCTTTGTCTACAGCTTCAAAAGCTTTCTGGGCTCTTTCTGGATCATCTTGATTTTTATCCGGATGAACAAGAATCGATAACTGGCGAAGTCTCTTCTTGACTTCCTCATCTGTTGCTTCTGGATCAATTTGCAGGAACTCCAAAGGGTTTAAGTTAAAGTTAGACAATCCAGGTCTAATCCATTCTTTCAATTTCTGCTTTGGGGGTAAAACGGAATCCAGTTTTTCAATTTCCTAAACCTCTTTGTTAAAACTTCAAAAAACACTCATCCCATGAACCCGAACAAGAACACCCAAAACACGGAGGCCGCCCCTTGCGTGCCAATCGTTTATGGAACAACAAG
Full Trace Sequence: AAAACGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTCTTTGCTCCATCTTCACTTTTGGTGGTTTTAAAAAGGTCCTTGCCTTCTTTTCTTTTTTTCCTTTTTTGTGCGATTGGAAGCTTCGCCAGCTATCCACTCGCCCATCTCGACTTTCCTCAAAGTTTTTCTGCCACTCTCTTTCCCTTTTGGCTTTTTCTTGAGTTTCTATTTCCTCTTCTCTCTGCCTCTTTCTTTCATGCATATCTTTTGCTTCTCTCTCTTTACGTTTGATTTCCAGCTCTGCAAAGAGCTTCATCGTCTGTTTGTACACAGCCTGTTTGAACACTTCAGGGTCATCTTCTTCAACTGTTAATGATTTTCCTTCCTTTTTCAACTGCTTCTTTTTTTCTTTTACAATATGTTCAACATATTCCTGTCCAGCTTGGATGACATCAATAGCCCTCTTTTTCTGCTCTGGTTCCAGGAGACCTTTATAGGCTTTGTCTACAGCTTCAAAAGCTTTCTGGGCTCTTTCTGGATCATCTTGATTTTTATCCGGATGAACAAGAATCGATAACTGGCGAAGTCTCTTCTTGACTTCCTCATCTGTTGCTTCTGGATCAATTTGCAGGAACTCCAAAGGGTTTAAGTTAAAGTTAGACAATCCAGGTCTAATCCATTCTTTCAATTTCTGCTTTGGGGGTAAAACGGAATCCAGTTTTTCAATTTCCTAAACCTCTTTGTTAAAACTTCAAAAAACACTCATCCCATGAACCCGAACAAGAACACCCAAAACACGGAGGCCGCCCCTTGCGTGCCAATCGTTTATGGAACAACAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTCTTTGCTCCATCTTCACT