ORFeome > dnase1l1 ORF1 – XORFeome v1.0

dnase1l1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dnase1l1
Gene ID: 6256155
Gene Page ID: 997641
ORF Xenbase ID: 17272905

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC129560
Original XGC clone length: 894

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ837823
dbEST ID: 79655525
Trimmed Sequence: ATGGTCCCTTGTGTTTGTGCAACCAAAATCTGTGCGTTTAACATGCAACATTTTGGAGAGAAGAAAGTAGCCAAGGAACATATATTAAACCTCATAGTTAAGATAATCCAGAGATGTGAGATCTCAGTTCTTCAGGAGGTGCAGGACCCCAAGGGGCTCGCTTTATCCAGACTTCTCCAGTCCCTAAATAAAGCTCATAAGAAAGACACATTCATGGCTGTCACCAGCCCCCCCTTGGGCAGGAAATCCTACACAGAGCAGTATGTCTTTATATACAGATCTGACAAAGTCCAAGCAACCCAACAGTACAAATACGCTGATGATGACTCTGATGCCCCCGATGTCTTTGCTCGAGAGCCTTATATTGTGCGCTTCTCTGTGTTTGGCAAAGGGTTACGGGACCTGGTTCTGGTGCCCATGCACACAGTGCCAGAAAACGCATCCCGGGAAATAGATGCGCTGTATGATGTGTTCCTGGACATTATGGTACGCTGGGATGCAAAGAACATTCTGTTCCTTGGGGATTTCAATGCTGCTTGCAGTTACCTCTCCACGAAGAAGAAACGCACCCTTCGCCTATACCAAAACGAGCGATTCCATTGGTTTAACGATAACAGTGCAGACACCACCATCAGGGGCAGTACCAATTGTGCCCATTACAAAATTGTGGCGGATGGAGAACAACTGAAGAACAAATGTCCCAAACTGCTGGAATGGTAAAATTTTAAAAAAA
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTCCCTTGTGTTTGTGCAACCAAAATCTGTGCGTTTAACATGCAACATTTTGGAGAGAAGAAAGTAGCCAAGGAACATATATTAAACCTCATAGTTAAGATAATCCAGAGATGTGAGATCTCAGTTCTTCAGGAGGTGCAGGACCCCAAGGGGCTCGCTTTATCCAGACTTCTCCAGTCCCTAAATAAAGCTCATAAGAAAGACACATTCATGGCTGTCACCAGCCCCCCCTTGGGCAGGAAATCCTACACAGAGCAGTATGTCTTTATATACAGATCTGACAAAGTCCAAGCAACCCAACAGTACAAATACGCTGATGATGACTCTGATGCCCCCGATGTCTTTGCTCGAGAGCCTTATATTGTGCGCTTCTCTGTGTTTGGCAAAGGGTTACGGGACCTGGTTCTGGTGCCCATGCACACAGTGCCAGAAAACGCATCCCGGGAAATAGATGCGCTGTATGATGTGTTCCTGGACATTATGGTACGCTGGGATGCAAAGAACATTCTGTTCCTTGGGGATTTCAATGCTGCTTGCAGTTACCTCTCCACGAAGAAGAAACGCACCCTTCGCCTATACCAAAACGAGCGATTCCATTGGTTTAACGATAACAGTGCAGACACCACCATCAGGGGCAGTACCAATTGTGCCCATTACAAAATTGTGGCGGATGGAGAACAACTGAAGAACAAATGTCCCAAACTGCTGGAATGGTAAAATTTTAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTCCCTTGTGTTTGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837822
dbEST ID: 79655524
Trimmed Sequence: GTATATTGGGGTCTTTTCCCAAGTCTGTGATATAAATGATACCAGGAAACTCAGGGCGAGCAGAGTGCATGATGGTAGGAGAGGGTTCTGTCCATTCAGATCCAGTTCCACCGGGTAATGGTCACTGATTTCCAGGGCCTGTATCTCACTGAGTCCCAACTCTTTTGTAAAATTATACACTCCAGCAGTCTGGACATTGGTCATCAGCTGCTCTCCATACGCCACAATCCTGTCATAGGCACAATTGGTACTGCCCCTGACTGTGGTGTCTGCACTGTCATCGATCAACCAATGGAATCGCTCGTCTTTGTATAGGCGAAGGGTGCGCTTCTTCTTCCTGGAGAGGTAACTGCAAGCAGCATTGAAATCCCCAAGGAACAGAATGTTCTTTGCATCCCAGCGTACCATAATGTCCAGGAACACATCATACAGCGCATCTATTTCCCGGGATGCGTTTTCTGGCACTGTGTGCATGGGCACCAGAACCAGGTCCCGTAACCCTTTGCCAAACACAGAGAAGCGCACAATATAAAGCTCTCGAGCAAAGACATCGGGGGCATCAAAGTCATCATCAACGTATTTGTACTGTTGGGTTGCTTGGACTTTGTCAAATCTGTATATGAAGACATACTGCTCTGTGTAAGATTACCCGGCCAAGGGGGGGCTGGTGACAGCCATGAATGTGTCTTTCTTATGAACCTTATTTAGGGAACGGGAAAAGTCGGAATAAAGCGAACCCCTTGGGGCCCTGCGCCTCCCGAAAAAACTAAAAATTCAAATCTCTTGAATTATCTTAACTATAAGGTTTAATATGTGGTCCCTTGGCTACGTGTCTTCTCTGCCAAAGTGTGCCAGGTAGGAGGCAAGAAATTTGGGGTTCGACAAGCGCAAGGAAACAATGGGGGCGAGTTGTGTTGAGACAAAGGGTGGGATTTTAAAAAAGCAATAAATCAAAAAGTTGTTGTGGAGGGAAAAGGTCCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATGTACTCGGCCGTTGAAGAAGGGGCCCGGCGCGGTTTAAACAAACACCCAATGACCTGGCTCAAACACGGTGGGGGGGGGGTAAGGTAGTACTCGTGGTGGATAGATAGAAAGCGCCAACCACCCGACCCAGAGGAAGACACAGCGCCCCGCGCGCGGCGACGAGCAGCTGTTCGATNTTTNAGACAGAGAAAAGCGACG
Full Trace Sequence: TGGCCGGGCAATCAGGCTATGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATATTGGGGTCTTTTCCCAAGTCTGTGATATAAATGATACCAGGAAACTCAGGGCGAGCAGAGTGCATGATGGTAGGAGAGGGTTCTGTCCATTCAGATCCAGTTCCACCGGGTAATGGTCACTGATTTCCAGGGCCTGTATCTCACTGAGTCCCAACTCTTTTGTAAAATTATACACTCCAGCAGTCTGGACATTGGTCATCAGCTGCTCTCCATACGCCACAATCCTGTCATAGGCACAATTGGTACTGCCCCTGACTGTGGTGTCTGCACTGTCATCGATCAACCAATGGAATCGCTCGTCTTTGTATAGGCGAAGGGTGCGCTTCTTCTTCCTGGAGAGGTAACTGCAAGCAGCATTGAAATCCCCAAGGAACAGAATGTTCTTTGCATCCCAGCGTACCATAATGTCCAGGAACACATCATACAGCGCATCTATTTCCCGGGATGCGTTTTCTGGCACTGTGTGCATGGGCACCAGAACCAGGTCCCGTAACCCTTTGCCAAACACAGAGAAGCGCACAATATAAAGCTCTCGAGCAAAGACATCGGGGGCATCAAAGTCATCATCAACGTATTTGTACTGTTGGGTTGCTTGGACTTTGTCAAATCTGTATATGAAGACATACTGCTCTGTGTAAGATTACCCGGCCAAGGGGGGGCTGGTGACAGCCATGAATGTGTCTTTCTTATGAACCTTATTTAGGGAACGGGAAAAGTCGGAATAAAGCGAACCCCTTGGGGCCCTGCGCCTCCCGAAAAAACTAAAAATTCAAATCTCTTGAATTATCTTAACTATAAGGTTTAATATGTGGTCCCTTGGCTACGTGTCTTCTCTGCCAAAGTGTGCCAGGTAGGAGGCAAGAAATTTGGGGTTCGACAAGCGCAAGGAAACAATGGGGGCGAGTTGTGTTGAGACAAAGGGTGGGATTTTAAAAAAGCAATAAATCAAAAAGTTGTTGTGGAGGGAAAAGGTCCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATGTACTCGGCCGTTGAAGAAGGGGCCCGGCGCGGTTTAAACAAACACCCAATGACCTGGCTCAAACACGGTGGGGGGGGGGTAAGGTAGTACTCGTGGTGGATAGATAGAAAGCGCCAACCACCCGACCCAGAGGAAGACACAGCGCCCCGCGCGCGGCGACGAGCAGCTGTTCGATNTTTNAGACAGAGAAAAGCGACG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATATTGGGGTCTTTTCCCAAGT