ORFeome > dnlz ORF1 – XORFeome v1.0

dnlz ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dnlz
Gene ID: 940252
Gene Page ID: 940249
ORF Xenbase ID: 17272923

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123327
Original XGC clone length: 567

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ837342
dbEST ID: 79655044
Trimmed Sequence: ATGCTGTTTCAGAGTTGCGGGCTCCTGTCAGCGTTGGGCAGAATCGGCAGCCGGTCGCCAGTCACTCGTGGGATATTGGCACGGGCAGCTGTGGTATGGGCGCGGGATGTAGACGGCAACTGGGGGGCTCCTACAGTGAGTCGCCTTGTGACCGGGCACCTCCATAAATGTGTTCGGCCGCCTTGGACTGTGCCACTTGCCGGACGTCTTTACTGTACGTTACCCGCCGCCCCATCCTCTCACTATCGGCTCATTTACACTTGCAAGGTCTGCGCCACCAGGTCCAGCAAAACTATCTCCAAAGTGGCCTATCACAAGGGAGTGGTGATCGTCAGGTGCCCCGGCTGCGAAAACCATCACATCATCGCCGACAACCTGGGCTGGTTCTCTGACCTGGAAGGGAGAAGGAACATTGAGGAGATTCTGGCGGCTAAAGGGGAACAAGTGCAGCGATTAGTCGGGGACGACGCTGTGGAAATCCTGCTCAGAAATGCCGGGGAGTCGGCGACTCAGGATGGAGACAAAACTGGGGAAGCGGAATCTGCAGGAAATAAGCTTCTCTCCTT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTTTCAGAGTTGCGGGCTCCTGTCAGCGTTGGGCAGAATCGGCAGCCGGTCGCCAGTCACTCGTGGGATATTGGCACGGGCAGCTGTGGTATGGGCGCGGGATGTAGACGGCAACTGGGGGGCTCCTACAGTGAGTCGCCTTGTGACCGGGCACCTCCATAAATGTGTTCGGCCGCCTTGGACTGTGCCACTTGCCGGACGTCTTTACTGTACGTTACCCGCCGCCCCATCCTCTCACTATCGGCTCATTTACACTTGCAAGGTCTGCGCCACCAGGTCCAGCAAAACTATCTCCAAAGTGGCCTATCACAAGGGAGTGGTGATCGTCAGGTGCCCCGGCTGCGAAAACCATCACATCATCGCCGACAACCTGGGCTGGTTCTCTGACCTGGAAGGGAGAAGGAACATTGAGGAGATTCTGGCGGCTAAAGGGGAACAAGTGCAGCGATTAGTCGGGGACGACGCTGTGGAAATCCTGCTCAGAAATGCCGGGGAGTCGGCGACTCAGGATGGAGACAAAACTGGGGAAGCGGAATCTGCAGGAAATAAGCTTCTCTCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTTGCATCCAGCTGAAATCCCCTATAGTGAGTCCTATTTCCTTGAAATAAAAAAAAATAAATAGTAAATCTGACCATTTCTCATACTCTCTCCTAACTGTTTAAAAAAAAAAAAAAACATCTCTCTCTTCCGCCGCGGGGGTGGGTGTGGGTGTTGTTCTTGTTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTTTCAGAGTTGCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837341
dbEST ID: 79655043
Trimmed Sequence: GGAGAGAAGCTTATTTCCTGCAGATTCCGCTTCCCCAGTTTTGTCTCCATCCTGAGTCGCCGACTCCCCGGCATTTCTGAGCAGGATTTCCACAGCGTCGTCCCCGACTAATCGCTGCACTTGTTCCCCTTTAGCCGCCAGAATCTCCTCAATGTTCCTTCTCCCTTCCAGGTCAGAGAACCAGCCCAGGTTGTCGGCGATGATGTGATGGTTTTCGCAGCCGGGGCACCTGACGATCACCACTCCCTTGTGATAGGCCACTTTGGAGATAGTTTTGCTGGACCTGGTGGCGCAGACCTTGCAAGTGTAAATGAGCCGATAGTGAGAGGATGGGGCGGCGGGTAACGTACAGTAAAGACGTCCGGCAAGTGGCACAGTCCAAGGCGGCCGAACACATTTATGGAGGTGCCCGGTCACAAGGCGACTCACTGTAGGAGCCCCCCAGTTGCCGTCTACATCCCGCGCCCATACCACAGCTGCCCGTGCCAATATCCCACGAGTGACTGGCGACCGGCTGCCGATTCTGCCCAACGCTGACAGGAGCCCGCAACTCTTAAACAGCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGAGAAGCTTATTTCCTGCAGATTCCGCTTCCCCAGTTTTGTCTCCATCCTGAGTCGCCGACTCCCCGGCATTTCTGAGCAGGATTTCCACAGCGTCGTCCCCGACTAATCGCTGCACTTGTTCCCCTTTAGCCGCCAGAATCTCCTCAATGTTCCTTCTCCCTTCCAGGTCAGAGAACCAGCCCAGGTTGTCGGCGATGATGTGATGGTTTTCGCAGCCGGGGCACCTGACGATCACCACTCCCTTGTGATAGGCCACTTTGGAGATAGTTTTGCTGGACCTGGTGGCGCAGACCTTGCAAGTGTAAATGAGCCGATAGTGAGAGGATGGGGCGGCGGGTAACGTACAGTAAAGACGTCCGGCAAGTGGCACAGTCCAAGGCGGCCGAACACATTTATGGAGGTGCCCGGTCACAAGGCGACTCACTGTAGGAGCCCCCCAGTTGCCGTCTACATCCCGCGCCCATACCACAGCTGCCCGTGCCAATATCCCACGAGTGACTGGCGACCGGCTGCCGATTCTGCCCAACGCTGACAGGAGCCCGCAACTCTTAAACAGCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTAATAAAAAACATTGCTCATCAATTTGGTGGCAACGAACAGGGTCACTATCCGTCGAAATAAAAATCTTTAAAAAAAAAAAAAAAGCATAAAAAATAGACCTCTTTTAACACCCCCTTCTCCCCCGTCGGGAAAAAAAAACAAAGACTTTTTTCGCCCCCCACCCGGGCGTTTTGGTTTGTACTTCCTTCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGAGAAGCTTATTTCCTG