ORFeome > dock10 ORF1 – XORFeome v1.0

dock10 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dock10
Gene ID: 1004974
Gene Page ID: 1004970
ORF Xenbase ID: 17272953

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153763
Original XGC clone length: 1314

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ839010
dbEST ID: 79656712
Trimmed Sequence: ATGACACTGGATGATGCACAAAACCCTGATAATAACCTCTTACTAACCTCAACCACTGGAAAAAGTATTTTCTCCATGGGGTGGCCCGCTTTCCACAGCATTACTCCAAATATCAAAGAAGAAGGAGCAATGAAAGAAGATTCAGGGATGCAGGATACACCATATAATGAGAACGCTCTGGTGGAACAACTGGACCTCTGTGTTGACTACCTGTGGAAGTCGGAACGGTTTGAGCTGATTGCGGAAGTGAGCAAACCTGTCATTGCTGTGTTCGAGAAGCAGCGAGACTTTAAAAGGCTGTCAGAGTTGTATTATAACATACATCGATCCTACCTAAAAATTGCAGAAGTTGTGAATGCAGAGAAGAGATTATTTGGGAGGTATTACCGAGTTGCCTTCTATGGACAGGGCTTCTTTGAAGAAGAAGAAGGAAAAGAATACATCTATAAGGAACCTAAATTAACAGGCTTATCGGAAATTTCCCAACGACTGCTAAAACTCTATGCTGATAAATTTGGAGCAGACAATGTTAAGATTATTCAAGACTCCAATAAGGTCAACCCAAAAGAACTTGATTCAAAAATTGCCTATATCCAAGTTACTTATGTGACTCCTTATTTTGATGAGAAAGAGCTGATGGACAGAAAAACTGATTTTTAGAAACATCAGCATATCCACCAAATTGTATTTGAAACCCCCTTCACACTTTCCTGGAAAAAATCATGGGAGGCGTCCAAGGAACAGTGCAAAAAAACAAACGGTTCCTTCAGAAAAGTCCATTTCCTTTCCTTAATTGAAAAAAAACGGAATCCCAAGTTTCTGAAA
Full Trace Sequence: CGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACACTGGATGATGCACAAAACCCTGATAATAACCTCTTACTAACCTCAACCACTGGAAAAAGTATTTTCTCCATGGGGTGGCCCGCTTTCCACAGCATTACTCCAAATATCAAAGAAGAAGGAGCAATGAAAGAAGATTCAGGGATGCAGGATACACCATATAATGAGAACGCTCTGGTGGAACAACTGGACCTCTGTGTTGACTACCTGTGGAAGTCGGAACGGTTTGAGCTGATTGCGGAAGTGAGCAAACCTGTCATTGCTGTGTTCGAGAAGCAGCGAGACTTTAAAAGGCTGTCAGAGTTGTATTATAACATACATCGATCCTACCTAAAAATTGCAGAAGTTGTGAATGCAGAGAAGAGATTATTTGGGAGGTATTACCGAGTTGCCTTCTATGGACAGGGCTTCTTTGAAGAAGAAGAAGGAAAAGAATACATCTATAAGGAACCTAAATTAACAGGCTTATCGGAAATTTCCCAACGACTGCTAAAACTCTATGCTGATAAATTTGGAGCAGACAATGTTAAGATTATTCAAGACTCCAATAAGGTCAACCCAAAAGAACTTGATTCAAAAATTGCCTATATCCAAGTTACTTATGTGACTCCTTATTTTGATGAGAAAGAGCTGATGGACAGAAAAACTGATTTTTAGAAACATCAGCATATCCACCAAATTGTATTTGAAACCCCCTTCACACTTTCCTGGAAAAAATCATGGGAGGCGTCCAAGGAACAGTGCAAAAAAACAAACGGTTCCTTCAGAAAAGTCCATTTCCTTTCCTTAATTGAAAAAAAACGGAATCCCAAGTTTCTGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACACTGGATGATGCACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839009
dbEST ID: 79656711
Trimmed Sequence: GGGATCGGCTTTGGAGGATGAGCTCTGCAGGCTTGGGTATGTCCTACTGACTGATCGAAGAGTACACGGCCTTTCTGCTCCTTGCTGCTTTGCCAGCTCCTCTCGGTATGGGATCTGTTCATTCATGACTTCCGATAGTTCTGTCAGGATTTCTCTATAATGGGACTTCATCTCTTCTTGATATTCAAGCTGATCCTCCTTTATTAACCGTCCGTTCACTTCCAGAGCAAGGCCACATGTATCTGCAAATTGCCTGAAGATTTCCTTTAGGTGCCGAACTTGACTTTCAGGATAATTACTGGAATTTGATTCAGTTAGAAATTCCCGTGCATATGCCATAGGCCCAGCATTTACCTTCACACTGACACTTCCTTGAAGTTTGAGCTGTAACCTTATCATGTCAACATCATCCATTGTGCAAAGCTGCTGGAGTTCCTGAACCTTCTTGGTCATTTCATCTATAGCGACCTCTATGGGATTGAGCTCCGTGCTCGTCTGGTTCACGACTTGGATCCGTTTCTTCACATAAGGGAAGGAATGAATTGTTGTGAGCACAGTCTGTCGTTTGCACTGTTCCTCGACGCCGCCCTGCTTTTTTCCAAAAGTTGTAAAGGGGGGTTCCAAGTACAATTCTGTTTAATTTTGTGATGCCTTCCCCAAAATCCGTTTTTTCCTGTCCATCCAGCTCCTTTCCCCTCCAAAAAAAAAGAAGACCCCAGAAAGATGGCTTTTGGAATATAAGGGCAAATTTTTTGGTAAATTAGA
Full Trace Sequence: GAAACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGATCGGCTTTGGAGGATGAGCTCTGCAGGCTTGGGTATGTCCTACTGACTGATCGAAGAGTACACGGCCTTTCTGCTCCTTGCTGCTTTGCCAGCTCCTCTCGGTATGGGATCTGTTCATTCATGACTTCCGATAGTTCTGTCAGGATTTCTCTATAATGGGACTTCATCTCTTCTTGATATTCAAGCTGATCCTCCTTTATTAACCGTCCGTTCACTTCCAGAGCAAGGCCACATGTATCTGCAAATTGCCTGAAGATTTCCTTTAGGTGCCGAACTTGACTTTCAGGATAATTACTGGAATTTGATTCAGTTAGAAATTCCCGTGCATATGCCATAGGCCCAGCATTTACCTTCACACTGACACTTCCTTGAAGTTTGAGCTGTAACCTTATCATGTCAACATCATCCATTGTGCAAAGCTGCTGGAGTTCCTGAACCTTCTTGGTCATTTCATCTATAGCGACCTCTATGGGATTGAGCTCCGTGCTCGTCTGGTTCACGACTTGGATCCGTTTCTTCACATAAGGGAAGGAATGAATTGTTGTGAGCACAGTCTGTCGTTTGCACTGTTCCTCGACGCCGCCCTGCTTTTTTCCAAAAGTTGTAAAGGGGGGTTCCAAGTACAATTCTGTTTAATTTTGTGATGCCTTCCCCAAAATCCGTTTTTTCCTGTCCATCCAGCTCCTTTCCCCTCCAAAAAAAAAGAAGACCCCAGAAAGATGGCTTTTGGAATATAAGGGCAAATTTTTTGGTAAATTAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGATCGGCTTTGGAGG