ORFeome > dohh ORF1 – XORFeome v1.0

dohh ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dohh
Gene ID: 6254335
Gene Page ID: 6258031
ORF Xenbase ID: 17272959

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078568
Original XGC clone length: 912

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ839888
dbEST ID: 79657590
Trimmed Sequence: ATGGCGGCTTCCTTAAGCAGCGAAGTGCATAGCTTGGGTCAGTTGTTAATAGACCCTGGAAAACCTTTGCCTTTAAGGTTCCGGGCGCTTTTTACGTTGCGGAACCTTGGGGGTGCTGAGGCCATTGACTGTATCGGCCGTGGTTTCCAGGACGAGTCGGCACTGCTTAAGCATGAGCTGGCCTACTGCCTTGGGCAGATGAAAGATCGGAGGGCTCTGCCTGTGCTCAAACAAGTGTTACAAGACCGTCAACAGGAGCCTATGGTTCGGCATGAAGCAGGAGAAGCTTTGGGGGCTATTGGAGACCCTGAGGTGTTGGAATTGCTGAGAGAATATGCCCAGGACCCTGTGATAGAGGTTGCAGAAACTTGTCAGCTGGCCGTGAGTCGTATAGAGTGGCTTCAGAAGAATCCAGATTCCCCAGATACTAATCCTTATTTATCTGTGGACCCTGCTCCTCCTGCTGAGGAAAAAGATGTTCCTACACTTCGCGCAACACTGTTAGATGAAACCTGCCCACTGTTTCACCGATATCGTGCTATGTTTGCGTTGCGCAATATTGAAGGAGAAGAGGCTGTGTTGGCACTTGCAGATGGCTTGCAAATCCGTGGGTCCCTATTCCGTCATGAGGTTGGTTATGTGTTAAGGTCAAATGCAACATAAGGCACCTGTCCCAGGATTGTCTGCAACATTGGAACCATTTTTAGAAAAACCCAATGGTTTCGCCATTAATTTTGCTAAAAACTCCTTGGTTTCATTTGCCCCTTGAAAATTTTTCTAAAAAGGCACCTTCCGGGGCCCATTTTTTGGTTTAAG
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTTCCTTAAGCAGCGAAGTGCATAGCTTGGGTCAGTTGTTAATAGACCCTGGAAAACCTTTGCCTTTAAGGTTCCGGGCGCTTTTTACGTTGCGGAACCTTGGGGGTGCTGAGGCCATTGACTGTATCGGCCGTGGTTTCCAGGACGAGTCGGCACTGCTTAAGCATGAGCTGGCCTACTGCCTTGGGCAGATGAAAGATCGGAGGGCTCTGCCTGTGCTCAAACAAGTGTTACAAGACCGTCAACAGGAGCCTATGGTTCGGCATGAAGCAGGAGAAGCTTTGGGGGCTATTGGAGACCCTGAGGTGTTGGAATTGCTGAGAGAATATGCCCAGGACCCTGTGATAGAGGTTGCAGAAACTTGTCAGCTGGCCGTGAGTCGTATAGAGTGGCTTCAGAAGAATCCAGATTCCCCAGATACTAATCCTTATTTATCTGTGGACCCTGCTCCTCCTGCTGAGGAAAAAGATGTTCCTACACTTCGCGCAACACTGTTAGATGAAACCTGCCCACTGTTTCACCGATATCGTGCTATGTTTGCGTTGCGCAATATTGAAGGAGAAGAGGCTGTGTTGGCACTTGCAGATGGCTTGCAAATCCGTGGGTCCCTATTCCGTCATGAGGTTGGTTATGTGTTAAGGTCAAATGCAACATAAGGCACCTGTCCCAGGATTGTCTGCAACATTGGAACCATTTTTAGAAAAACCCAATGGTTTCGCCATTAATTTTGCTAAAAACTCCTTGGTTTCATTTGCCCCTTGAAAATTTTTCTAAAAAGGCACCTTCCGGGGCCCATTTTTTGGTTTAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTTCCTTAAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839887
dbEST ID: 79657589
Trimmed Sequence: TATTTGTTCACAAATTTGGCTTAATCCATTTGCATACTGGAAGTCCCCACTGTTCTCATAGTCATGCATATCCAAGGCCACCTCACAGCTCTCTCTCACAACTCTTTCTCCATCACCAACATGTGCACGAAGTGCCTTTAGACAATCTTCATGGGCAATAGAACCAAGAGCTTCAGCACACTCATGCCGAACCATAGGGTTCTCCTCAAATCGCTCCAATGCTGCAGACAATCCTGGGACAGCTGCCTTATGTTGCATCTGACCTAACACATAACCAATCTCATGACGGAATAGGGACCCACCGATCTGCAAGCCATCTGCAAGTGCCAACACAGCCTCTTCTCCTCCAATATTGCGCAACGCAAACATAGCACGATATCGGTGAAACAGTGGGCAGGTTTCATCTAACAGTGTTGCGCGAAGTGTAGGAACATCTTTTTCCTCAGCAGGAGGAGCAGGGTCCACAGATAAATAAGGATTAGTATCTGGGGAATCTGGATTCTTCTGAAGCCACTCTATACGACTCACGGCCAGCTGACAAGTTTCTGCAACCTCTATCACAGGGTCCTGGGCATATTCTCTCAGCAATCCNACACCTCAGGGTCTCCATAGCCCCCAAAGCTTCTCCTGCTTCATGCCGACCATAAGCTCCTGTTGACGGTCTTTGTACACTTGTTTGAGCACAGGCGAGCCCCTCCCATCTTTCATCTGCCCAAGGCAGATAGGCCAGCTCATGCCTAAACCAATGCCCGACTCCTTCCCGGGAAAACC
Full Trace Sequence: GAAAACCGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTTGTTCACAAATTTGGCTTAATCCATTTGCATACTGGAAGTCCCCACTGTTCTCATAGTCATGCATATCCAAGGCCACCTCACAGCTCTCTCTCACAACTCTTTCTCCATCACCAACATGTGCACGAAGTGCCTTTAGACAATCTTCATGGGCAATAGAACCAAGAGCTTCAGCACACTCATGCCGAACCATAGGGTTCTCCTCAAATCGCTCCAATGCTGCAGACAATCCTGGGACAGCTGCCTTATGTTGCATCTGACCTAACACATAACCAATCTCATGACGGAATAGGGACCCACCGATCTGCAAGCCATCTGCAAGTGCCAACACAGCCTCTTCTCCTCCAATATTGCGCAACGCAAACATAGCACGATATCGGTGAAACAGTGGGCAGGTTTCATCTAACAGTGTTGCGCGAAGTGTAGGAACATCTTTTTCCTCAGCAGGAGGAGCAGGGTCCACAGATAAATAAGGATTAGTATCTGGGGAATCTGGATTCTTCTGAAGCCACTCTATACGACTCACGGCCAGCTGACAAGTTTCTGCAACCTCTATCACAGGGTCCTGGGCATATTCTCTCAGCAATCCNACACCTCAGGGTCTCCATAGCCCCCAAAGCTTCTCCTGCTTCATGCCGACCATAAGCTCCTGTTGACGGTCTTTGTACACTTGTTTGAGCACAGGCGAGCCCCTCCCATCTTTCATCTGCCCAAGGCAGATAGGCCAGCTCATGCCTAAACCAATGCCCGACTCCTTCCCGGGAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTTGTTCACAAATTTGGCT