ORFeome > dph5 ORF1 – XORFeome v1.0

dph5 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dph5
Gene ID: 965473
Gene Page ID: 965467
ORF Xenbase ID: 17273019

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054245
Original XGC clone length: 726

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ839560
dbEST ID: 79657262
Trimmed Sequence: ATGCTGTATTTGATAGGTTTAGGCCTCGGAGATGAGAAGGATGTGACTTTAAAAGGGCTGGAGGTGATCCGCAGCTGTGCCAGGGTGTACCTAGAAGCTTACACCTCTATACTCACCGTCAGAAAGGAAACGTTGGAAGAGTTTTATGGAAGGGAGTTGATCCTTGCTGACCGGGAGACAGTCGAGCAAGAGGCTGACGAAATACTGCGCGATGCTGCTGTCAGTGATGTAGCACTTCTTGTGGTTGGTGATCCTTTTGGGGCTACAACCCATAGTGACCTGGTCCTACGAGCAGCTAAGGCAGGAATCCAGCACCATGTTATTCACAATGCTTCCATCATGACTGCTGTGGGCTGTTGTGGTCTTCAGCTTTATAACTTTGGAGAGACAGTCTCAATAGTCTTCTGGACAGACATGTGGAAGCCCGAAAGCTTCTATGACAAAATTAGGAGGAACCGACTAAGCGGGATGCATACTTTGTGCCTGTTAGATATAAAAGTGAAAGAGCAATCAATAGAGAACCTCATGAACTTTAACGGAGAACACAATCTGTGTGGGACTGGCTCGTGTTGGTGCTTCGGACCAGAAAATATCAGCCGGGACCCTGCAGCAGCTAAGCTCGGTGGACTTTGGGGGTCCTCTTCACTCTCTGGCGATCAGTGGTTGTATGCACCCTTTTAAACTGGACATGCTAAACCTCTTTGCTGTGAAACCATCCACTTTTTGCCACTTTCTTGTACAAATTTGGCTTTAAAAGAAACCTTTCCTAATCATTTTGTTGCCACCAAACAGGTCCCTATTCCGTTCAAAATAAAAACC
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTATTTGATAGGTTTAGGCCTCGGAGATGAGAAGGATGTGACTTTAAAAGGGCTGGAGGTGATCCGCAGCTGTGCCAGGGTGTACCTAGAAGCTTACACCTCTATACTCACCGTCAGAAAGGAAACGTTGGAAGAGTTTTATGGAAGGGAGTTGATCCTTGCTGACCGGGAGACAGTCGAGCAAGAGGCTGACGAAATACTGCGCGATGCTGCTGTCAGTGATGTAGCACTTCTTGTGGTTGGTGATCCTTTTGGGGCTACAACCCATAGTGACCTGGTCCTACGAGCAGCTAAGGCAGGAATCCAGCACCATGTTATTCACAATGCTTCCATCATGACTGCTGTGGGCTGTTGTGGTCTTCAGCTTTATAACTTTGGAGAGACAGTCTCAATAGTCTTCTGGACAGACATGTGGAAGCCCGAAAGCTTCTATGACAAAATTAGGAGGAACCGACTAAGCGGGATGCATACTTTGTGCCTGTTAGATATAAAAGTGAAAGAGCAATCAATAGAGAACCTCATGAACTTTAACGGAGAACACAATCTGTGTGGGACTGGCTCGTGTTGGTGCTTCGGACCAGAAAATATCAGCCGGGACCCTGCAGCAGCTAAGCTCGGTGGACTTTGGGGGTCCTCTTCACTCTCTGGCGATCAGTGGTTGTATGCACCCTTTTAAACTGGACATGCTAAACCTCTTTGCTGTGAAACCATCCACTTTTTGCCACTTTCTTGTACAAATTTGGCTTTAAAAGAAACCTTTCCTAATCATTTTGTTGCCACCAAACAGGTCCCTATTCCGTTCAAAATAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTATTTGATAGGTTTAGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839559
dbEST ID: 79657261
Trimmed Sequence: AAAGTGGATGGTTCCACAGCAAAGAGCTTTAGCATGTCCAGTTCTAAAGGGTGCATACAACCACTGATCGCCAGAGAGTGAAGAGGACCCCCAAAGTCCACCGAGCTTAGCTGCTGCAGGGTCCCGGCTGATATTTTCTGGTCCGAAGCACCAACACGAGCCAGTCCCACACAGATTGTGTTCTCCGTTAAAGTTCATGAGGTTCTCTATTGATTGCTCTTTCACTTTTATATCTAACAGGCACAAAGTATGCATCCCGCTTAGTCGGTTCCTCCTAATTTTGTCATAGAAGCTTTCGGGCTTCCACATGTCTGTCCAGAAGACTATTGAGACTGTCTCTCCNAAGTTATAAAGCTGAAGACCACAACAGCCCACAGCAGTCATGATGGAAGCATTGTGAATAACATGGTGCTGGATTCCTGCCTTAGCTGCTCGTAGGACCAGGTCACTATGGGTTGTAGCCCCAAAAGGATCACCAACCACAAGAAGTGCTACATCACTGACAGCAGCATCGCGCAGTATTTCGTCAGCCTCTTGCTCGACTGTCTCCCGGTCAGCAGGGATCAACTCCCCTTCCTAATACTCTTCCCACGGTTTCCTTTCTGACGGTGAGTTTAGAGGTGTAAGCTTCTAGGTACACCCCTGGCAAGCTGGCGAACACCTCCGGCCCTTTTAAAGTTCAAATCCTCTCATCTCCCCAGGGCTAAACCTGTTGAATACAAAAAGGTTGGCAAACTTTTTTTGGCTCAATGTTTGGGGGTTAAGAAAAAN
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGTGGATGGTTCCACAGCAAAGAGCTTTAGCATGTCCAGTTCTAAAGGGTGCATACAACCACTGATCGCCAGAGAGTGAAGAGGACCCCCAAAGTCCACCGAGCTTAGCTGCTGCAGGGTCCCGGCTGATATTTTCTGGTCCGAAGCACCAACACGAGCCAGTCCCACACAGATTGTGTTCTCCGTTAAAGTTCATGAGGTTCTCTATTGATTGCTCTTTCACTTTTATATCTAACAGGCACAAAGTATGCATCCCGCTTAGTCGGTTCCTCCTAATTTTGTCATAGAAGCTTTCGGGCTTCCACATGTCTGTCCAGAAGACTATTGAGACTGTCTCTCCNAAGTTATAAAGCTGAAGACCACAACAGCCCACAGCAGTCATGATGGAAGCATTGTGAATAACATGGTGCTGGATTCCTGCCTTAGCTGCTCGTAGGACCAGGTCACTATGGGTTGTAGCCCCAAAAGGATCACCAACCACAAGAAGTGCTACATCACTGACAGCAGCATCGCGCAGTATTTCGTCAGCCTCTTGCTCGACTGTCTCCCGGTCAGCAGGGATCAACTCCCCTTCCTAATACTCTTCCCACGGTTTCCTTTCTGACGGTGAGTTTAGAGGTGTAAGCTTCTAGGTACACCCCTGGCAAGCTGGCGAACACCTCCGGCCCTTTTAAAGTTCAAATCCTCTCATCTCCCCAGGGCTAAACCTGTTGAATACAAAAAGGTTGGCAAACTTTTTTTGGCTCAATGTTTGGGGGTTAAGAAAAAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGTGGATGGTTCCACAG