ORFeome > dpysl2 ORF1 – XORFeome v1.0

dpysl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dpysl2
Gene ID: 1010786
Gene Page ID: 1010782
ORF Xenbase ID: 17273103

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059982
Original XGC clone length: 1722

Human orthology & disease relationships

NCBI Entrez ID: 1808
Ensembl gene IDs: ENSG00000092964
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 211980,607785,608594

Library Location

Plate ID: GDExl11017
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ824435
dbEST ID: 79642137
Trimmed Sequence: ATGTCAGGTTACCAGGGCAAGAAGAACATTCCCCGCATCACGAGCGATCGGCTACTCATTAAAGGTGGAAAAATCGTTAACGATGACCAGTCGTTTCATGCTGACATTTACATGGAGGATGGATTGATCAAGCAGATCGGTGAAAATCTGATTGTGCCGGGAGGAGTGAAGACCATCGAAGCTCATGGCAGGATGGTGGTTCCGGGCGGAATTGACGTCCATACTTGCTTCCAAAAACCGTGCAACGGCATGGTGTCTTCTGATGATTTCTTACAGGGAACCAAGGCAGCACTGGCAGGGGGCACCACTATGATCATTGATCACGTTGTGCCCGAACCTGGCTCCAGCCTGCTCAGCGCCTTTGATCAGTGGCGGGAATGGGCAGATGCCAAATCGTGCTGTGACTACTCCTTGCATGTAGATATCACTGAATGGCACAAGGGTGTTCAAGAGGAGATGGAGGCTCTTGTAAAGGATCATGGAGTGAACTCCTTCCTGGTTTACATGGCCTATAAGGACCAATACCAGCTCACCGACTCACAGATTTACGAGGTATTCAGTGTGATCCGTGACATTGGTGCCATTGCAGAGGTCCATGCGGAGAATGGGGATGTTATTGCAGAGGAGNCATTTAGGATTCTGGAAACAGGAATCACTGGCCCAGAAGGACATGTTTTGAGCCGACCAGAAGAAGTGGAAGCAGAGGCTGTGAATCGTTCTATCACCATCTCCAACCAGACCAACTGCCCCTTGAATGGTCACAAGGT
Full Trace Sequence: GGCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGGTTACCAGGGCAAGAAGAACATTCCCCGCATCACGAGCGATCGGCTACTCATTAAAGGTGGAAAAATCGTTAACGATGACCAGTCGTTTCATGCTGACATTTACATGGAGGATGGATTGATCAAGCAGATCGGTGAAAATCTGATTGTGCCGGGAGGAGTGAAGACCATCGAAGCTCATGGCAGGATGGTGGTTCCGGGCGGAATTGACGTCCATACTTGCTTCCAAAAACCGTGCAACGGCATGGTGTCTTCTGATGATTTCTTACAGGGAACCAAGGCAGCACTGGCAGGGGGCACCACTATGATCATTGATCACGTTGTGCCCGAACCTGGCTCCAGCCTGCTCAGCGCCTTTGATCAGTGGCGGGAATGGGCAGATGCCAAATCGTGCTGTGACTACTCCTTGCATGTAGATATCACTGAATGGCACAAGGGTGTTCAAGAGGAGATGGAGGCTCTTGTAAAGGATCATGGAGTGAACTCCTTCCTGGTTTACATGGCCTATAAGGACCAATACCAGCTCACCGACTCACAGATTTACGAGGTATTCAGTGTGATCCGTGACATTGGTGCCATTGCAGAGGTCCATGCGGAGAATGGGGATGTTATTGCAGAGGAGNCATTTAGGATTCTGGAAACAGGAATCACTGGCCCAGAAGGACATGTTTTGAGCCGACCAGAAGAAGTGGAAGCAGAGGCTGTGAATCGTTCTATCACCATCTCCAACCAGACCAACTGCCCCTTGAATGGTCACAAGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGGTTACCAGGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829791
dbEST ID: 79647493
Trimmed Sequence: GCCGAGGCTGGTGATGTTGGCACGGCCCCCGGGGGGAGCAACGATACGTTGAGTAGTGCGACGAGGGATGTTGTCATCAACCTGGGCCCCTGACAGGCTGAATCCAGATTGGTGCAGGTTCCGTATGGGTTGTGCTGGCTGTTTGGCTGGCGATGTCTTGGCAGAAGATGCTGGCGTTACAGCTTTGGGGGTAACGGAAACTTCACAGACAGGACCATCATACAGGCCACGGGGGACTCCTCGTAGCTCAGCAAGCCTGCTCCTGGCCTTGATCCTCTTGTACACGTAGTCTGGGAATGGTTTCCTTGGAATGTATCGCCCTGATCCCTCAGTAGCATGGAGGGTTCCCTCCTCGAGTACAATCTTTCCTTGGCTGATTACAACCAGGGGACTCCCGCGGCACTCCATGCCTTCAAAGATATTATACTCCACGTTACTATTGTGTGTCTTGGCTGAGATTGTCCTCAAGTTGTCTGGGTCCCAGATCACCAGGTCAGCATCGGATCCCACAGCAATGCGTCCTTTGCGCGGATACAGGTTGAAGATCTTTGCAGCATTTGTACTGGTGACAGCCACAAACTGGTTTTCATCCATCTTTCCAGTCACCACAGCTCGGTCCCACACAATGCTCATCCTTTTCTCAGCTCCATTCGTTCCCTCTGGGATTAGCCACAAAATGTCCTTTTCCACAGCTTTTCTAACCTGGTTTTAAAAGGGGCAGTGTGCCCCGCCCCCCAAACCCGTCGGGTACCCCCAGGGAAAACCAAA
Full Trace Sequence: ACGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCGAGGCTGGTGATGTTGGCACGGCCCCCGGGGGGAGCAACGATACGTTGAGTAGTGCGACGAGGGATGTTGTCATCAACCTGGGCCCCTGACAGGCTGAATCCAGATTGGTGCAGGTTCCGTATGGGTTGTGCTGGCTGTTTGGCTGGCGATGTCTTGGCAGAAGATGCTGGCGTTACAGCTTTGGGGGTAACGGAAACTTCACAGACAGGACCATCATACAGGCCACGGGGGACTCCTCGTAGCTCAGCAAGCCTGCTCCTGGCCTTGATCCTCTTGTACACGTAGTCTGGGAATGGTTTCCTTGGAATGTATCGCCCTGATCCCTCAGTAGCATGGAGGGTTCCCTCCTCGAGTACAATCTTTCCTTGGCTGATTACAACCAGGGGACTCCCGCGGCACTCCATGCCTTCAAAGATATTATACTCCACGTTACTATTGTGTGTCTTGGCTGAGATTGTCCTCAAGTTGTCTGGGTCCCAGATCACCAGGTCAGCATCGGATCCCACAGCAATGCGTCCTTTGCGCGGATACAGGTTGAAGATCTTTGCAGCATTTGTACTGGTGACAGCCACAAACTGGTTTTCATCCATCTTTCCAGTCACCACAGCTCGGTCCCACACAATGCTCATCCTTTTCTCAGCTCCATTCGTTCCCTCTGGGATTAGCCACAAAATGTCCTTTTCCACAGCTTTTCTAACCTGGTTTTAAAAGGGGCAGTGTGCCCCGCCCCCCAAACCCGTCGGGTACCCCCAGGGAAAACCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCGAGGCTGGTGATGT