ORFeome > dpysl4 ORF1 – XORFeome v1.0

dpysl4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dpysl4
Gene ID: 960298
Gene Page ID: 960291
ORF Xenbase ID: 17273121

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043880
Original XGC clone length: 2007

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ823937
dbEST ID: 79641639
Trimmed Sequence: ATGGCAGAGAGGAGCAGCAGGGAGAAAGTCAATGGAGAGAGCAACAACTTCTTTTCTACACTGGGCTCAGGGAGCCCCAAACCCAGGCAGAAATATGGAGGGGATGTTCTGCAATGTGGAGGGCGCTTTTGAAAATAAAACCATCAATTTTGACTCTCTCAGTGTCGGCAAGAAAAATGGCAGAAAGATGGAAATGAACAAGTCAAGTCCTGAATCGGATAGTGGGAGCGACTGTGGCAGTCTCAGCAGCCTGGACAGACAAGCAACTGACAATGTGGAAATCCAGGGGTCCACCAAGCTTAACACGGGGGATGCAACACCTCAGAGTGACCGACTGTTAATAAAAGGTGGGAAGATTGTGAACGATGATCAGTCCTTCCCCGCTGATATATATATTGAAGATGGTTTAATAAAGCAAATTGGAGAGAATCTAATTGTTCCTGGTGGGGTGAAAACCATTGATGCCCATGGGTTGCTGGTTATACCCGGAGGGATAGATGTTCACACAAGGCTACAGATGCCGGTTATGGGGATGACCAGCGCTGATGATTTCTTCCAAGGAACAAAAGCTGCACTTGCCGGGGGCACCACCATGATAATTGACCATGTCTTCTCTAACTCTGGAGTGAACCTGGTACAAGCCTACGACCAGTGGAGAGCATGCGCTGATGGCAGTGTGTGCTGTGATTATTCCCGTCATGTAGATATTACCCACTGGCACGAGAGCCTTGAAGAGGAATAAAAGGCATAATGGAAAGAAAAAGCTGTCAAATTCTTTTTTCTGTCTAATTGGGCTACCAAGAACAAAACCCCTGCACAAAACCCCAAAAATGGTTTAAAATTC
Full Trace Sequence: AATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAGAGGAGCAGCAGGGAGAAAGTCAATGGAGAGAGCAACAACTTCTTTTCTACACTGGGCTCAGGGAGCCCCAAACCCAGGCAGAAATATGGAGGGGATGTTCTGCAATGTGGAGGGCGCTTTTGAAAATAAAACCATCAATTTTGACTCTCTCAGTGTCGGCAAGAAAAATGGCAGAAAGATGGAAATGAACAAGTCAAGTCCTGAATCGGATAGTGGGAGCGACTGTGGCAGTCTCAGCAGCCTGGACAGACAAGCAACTGACAATGTGGAAATCCAGGGGTCCACCAAGCTTAACACGGGGGATGCAACACCTCAGAGTGACCGACTGTTAATAAAAGGTGGGAAGATTGTGAACGATGATCAGTCCTTCCCCGCTGATATATATATTGAAGATGGTTTAATAAAGCAAATTGGAGAGAATCTAATTGTTCCTGGTGGGGTGAAAACCATTGATGCCCATGGGTTGCTGGTTATACCCGGAGGGATAGATGTTCACACAAGGCTACAGATGCCGGTTATGGGGATGACCAGCGCTGATGATTTCTTCCAAGGAACAAAAGCTGCACTTGCCGGGGGCACCACCATGATAATTGACCATGTCTTCTCTAACTCTGGAGTGAACCTGGTACAAGCCTACGACCAGTGGAGAGCATGCGCTGATGGCAGTGTGTGCTGTGATTATTCCCGTCATGTAGATATTACCCACTGGCACGAGAGCCTTGAAGAGGAATAAAAGGCATAATGGAAAGAAAAAGCTGTCAAATTCTTTTTTCTGTCTAATTGGGCTACCAAGAACAAAACCCCTGCACAAAACCCCAAAAATGGTTTAAAATTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAGAGGAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829246
dbEST ID: 79646948
Trimmed Sequence: AGAGAGAGAGGTAATATTAGAACGGCCACCAGGGGGCGCCACTATTTTTTGTGTAGTGCGTCTTGGAATGTGGTCATCTTCTTGAGTTCCTGACAAACTGAATCCAGAGTGATGTAAGTTCCGAGCTGGTCCTATTTGAATCTTTCCAGGACAAGTTATTCTTGAAGCTGGTGTGGGTGCTGCTGACTTGCTGCTAATCGTGACATCGTGGACAGGTCCATCGTACAAGCCCCTAGGAACGCCACGTATTTCTGCGAGCCTGTTTCTAGCTTTGATCCTCTTGTACACATAATCGGGGAATGTTTTCCTGGGTACAAAACGTCCGGATCCCTGGCTCACATGGAGATTCCCATCTTCCAGTACAATCCTTCCTTGACTGATCACAACCTCTGGGGCACCATAACATTCCATCCCTTCAAATATGTTCAGCTCCACAGCCACATTGTGGGTCTTTGCGGAGATGATTTTTGCCGTTTTGGGATTCCAGATGATTAAATCGGCATCTGAACCTGCGGCGATCCTTCCCTTTCGGGGATACAAGTTAAAGAGTTTTGCAGCGTTGGTGCTGGTCACAGCCACAAATGCATTCTCGTCCATTTTGCCAGAAGTTACACATTTATCCCCAAATATTGTCATTCTTTCTTCTAATCCATTTTGTTCTTCAGGAATCAAGGGTGAAGTTTGTCTTTTCTAACGGCCCTTCTGCGCTTGTCGTTAAAGG
Full Trace Sequence: TGACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGAGAGAGGTAATATTAGAACGGCCACCAGGGGGCGCCACTATTTTTTGTGTAGTGCGTCTTGGAATGTGGTCATCTTCTTGAGTTCCTGACAAACTGAATCCAGAGTGATGTAAGTTCCGAGCTGGTCCTATTTGAATCTTTCCAGGACAAGTTATTCTTGAAGCTGGTGTGGGTGCTGCTGACTTGCTGCTAATCGTGACATCGTGGACAGGTCCATCGTACAAGCCCCTAGGAACGCCACGTATTTCTGCGAGCCTGTTTCTAGCTTTGATCCTCTTGTACACATAATCGGGGAATGTTTTCCTGGGTACAAAACGTCCGGATCCCTGGCTCACATGGAGATTCCCATCTTCCAGTACAATCCTTCCTTGACTGATCACAACCTCTGGGGCACCATAACATTCCATCCCTTCAAATATGTTCAGCTCCACAGCCACATTGTGGGTCTTTGCGGAGATGATTTTTGCCGTTTTGGGATTCCAGATGATTAAATCGGCATCTGAACCTGCGGCGATCCTTCCCTTTCGGGGATACAAGTTAAAGAGTTTTGCAGCGTTGGTGCTGGTCACAGCCACAAATGCATTCTCGTCCATTTTGCCAGAAGTTACACATTTATCCCCAAATATTGTCATTCTTTCTTCTAATCCATTTTGTTCTTCAGGAATCAAGGGTGAAGTTTGTCTTTTCTAACGGCCCTTCTGCGCTTGTCGTTAAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGAGAGAGGTAATATTAGAACG