ORFeome > drc1 ORF1 – XORFeome v1.0

drc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: drc1
Gene ID: 5967074
Gene Page ID: 5967063
ORF Xenbase ID: 17273133

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC055987
Original XGC clone length: 2073

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ824537
dbEST ID: 79642239
Trimmed Sequence: ATGAGTCTGTATGAGAGAGAGAGCGAGGAGAGCGCAGTCGCTGGCCCCTCATTGGACTCGGAGGATCAGCAGCAGCGAATTGAAGCCAGAAGACTTCGCATTGTGACTCGGATTGAAGCCAAGAGAAGGGAGGCACTGGGGGAGGACCTAAAGATCCTTAAAAAGAAGACAGAAGAGCCCAGGAAAAGCCATAAGCAGACAGAGGACAGCAGACAGAGACTGGGCAAGCTTGTGAATGATGGCTCCCAGCTGGTGACCAATATCCAGATAGCCACCGATGCCAGAGAGACCCAGAGGCGGGGGGAGGAGGAGGAGCTCAAGAGACTCAGGAGAGAGAAGCTGGACAATGAGGCCAAGAGCAGCCTAGAGAAGTTTGAAGAGATCACCAAGAGATGGACATTAGACAAAGCCAAGCAGGTCCCCCAGAAGATGTGGGAGATTCTGAATACACAACAGCAGCAGTGCGCCCAGCTCATCGAGGACAAGAATAACCTCATCAGTGACCTCCAGAAGGAGCTGCGGAGGAAAGACGACCAGTACGTGAAGGATCTGAAGAAACAGGCGGAGGACATAGACCTGCTGGTGGAGAGAATGGAGGAGCAGATTAAGAATTTAATCAAGACCTACCGCCAGGAGCTCCTGCAGATTGAGAAAGTCTTTGAGTTGGAACGGCGGGAGCTTTTACAGCAAATAGGAATACATGGGAGCAAGGGGATGCAGGGCGAAGGGACAAGGAGCTCGAGAGCCTGATGTCCCGGATGAAGAAGGTGGAGGAGTATGAGAAATCACTGAAGCAAGCTGAGGGGTGCAGGAAGGGGGG
Full Trace Sequence: CCATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTCTGTATGAGAGAGAGAGCGAGGAGAGCGCAGTCGCTGGCCCCTCATTGGACTCGGAGGATCAGCAGCAGCGAATTGAAGCCAGAAGACTTCGCATTGTGACTCGGATTGAAGCCAAGAGAAGGGAGGCACTGGGGGAGGACCTAAAGATCCTTAAAAAGAAGACAGAAGAGCCCAGGAAAAGCCATAAGCAGACAGAGGACAGCAGACAGAGACTGGGCAAGCTTGTGAATGATGGCTCCCAGCTGGTGACCAATATCCAGATAGCCACCGATGCCAGAGAGACCCAGAGGCGGGGGGAGGAGGAGGAGCTCAAGAGACTCAGGAGAGAGAAGCTGGACAATGAGGCCAAGAGCAGCCTAGAGAAGTTTGAAGAGATCACCAAGAGATGGACATTAGACAAAGCCAAGCAGGTCCCCCAGAAGATGTGGGAGATTCTGAATACACAACAGCAGCAGTGCGCCCAGCTCATCGAGGACAAGAATAACCTCATCAGTGACCTCCAGAAGGAGCTGCGGAGGAAAGACGACCAGTACGTGAAGGATCTGAAGAAACAGGCGGAGGACATAGACCTGCTGGTGGAGAGAATGGAGGAGCAGATTAAGAATTTAATCAAGACCTACCGCCAGGAGCTCCTGCAGATTGAGAAAGTCTTTGAGTTGGAACGGCGGGAGCTTTTACAGCAAATAGGAATACATGGGAGCAAGGGGATGCAGGGCGAAGGGACAAGGAGCTCGAGAGCCTGATGTCCCGGATGAAGAAGGTGGAGGAGTATGAGAAATCACTGAAGCAAGCTGAGGGGTGCAGGAAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCTGTATGAGAGAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829888
dbEST ID: 79647590
Trimmed Sequence: CGTGTGAGGATACTCCCCTTGCATCATTTGGGTTGGAGGGATTTCCAGTTCCACATTGATTTTGGAGTTGAGGTACTGGTGGAGCAGAGTCCGTAGCTCCGTGTTCTGCTGTCTCAGACTCACTGTCTCTGTTATCAGCTGCCCACGACTGCCAAGAACATCATAATATTTCTCCAGAGCAGATTCCAGCGCATCCCACACTCTAAATCGTGACTCAGGAATGGCTTTTGCTGCTGCCGCCCAGTATTCTGTGTCCTCCCTGCTGTCTCTTTCCTCCATCAGCCTCAGACGAGACACTTTCCCCCTGGGTTTCTGGAAGTCCATAACAAAAGCCTTGACGGCTCTCAGAACATCATTGGAGTGGATTAGTCCGTGAGCTTTAGACCCGGGTTCCAGGCTCCCCCCTGCGTCTCCTTCCTCCTCCGGTTCTCTCTTGTACCTACACAGGAACTCCACCAACTTGTACACGTCCTCCTCCACTGTCACGCCAAGAGCCCCGAAAATGGAGTCAAGTTTAATGAGGGACCTCTCATCCCTCTCCAGGGGGGACAGCAGCCGTGTGAGTTTGTTCTCTATCAGGAAGCCAGACTCATCGCAGAGTAACTCCAGGATGTGTTTAACAGTCTCTGCAGAGACCTCCCGGCACTGTCGTCCGTCTGTCTCTCCCTCGCTGGCTGGACTCTGGGTCACCGGGGGCATGAAAAGAAATGACTTCTTGCGCCTAAACTCACCCCTGAAATTTTTGTTCCTTGAAGCTTTTCCCCCCCAAGGG
Full Trace Sequence: CCGGGAAACAAGCTATGACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGTGTGAGGATACTCCCCTTGCATCATTTGGGTTGGAGGGATTTCCAGTTCCACATTGATTTTGGAGTTGAGGTACTGGTGGAGCAGAGTCCGTAGCTCCGTGTTCTGCTGTCTCAGACTCACTGTCTCTGTTATCAGCTGCCCACGACTGCCAAGAACATCATAATATTTCTCCAGAGCAGATTCCAGCGCATCCCACACTCTAAATCGTGACTCAGGAATGGCTTTTGCTGCTGCCGCCCAGTATTCTGTGTCCTCCCTGCTGTCTCTTTCCTCCATCAGCCTCAGACGAGACACTTTCCCCCTGGGTTTCTGGAAGTCCATAACAAAAGCCTTGACGGCTCTCAGAACATCATTGGAGTGGATTAGTCCGTGAGCTTTAGACCCGGGTTCCAGGCTCCCCCCTGCGTCTCCTTCCTCCTCCGGTTCTCTCTTGTACCTACACAGGAACTCCACCAACTTGTACACGTCCTCCTCCACTGTCACGCCAAGAGCCCCGAAAATGGAGTCAAGTTTAATGAGGGACCTCTCATCCCTCTCCAGGGGGGACAGCAGCCGTGTGAGTTTGTTCTCTATCAGGAAGCCAGACTCATCGCAGAGTAACTCCAGGATGTGTTTAACAGTCTCTGCAGAGACCTCCCGGCACTGTCGTCCGTCTGTCTCTCCCTCGCTGGCTGGACTCTGGGTCACCGGGGGCATGAAAAGAAATGACTTCTTGCGCCTAAACTCACCCCTGAAATTTTTGTTCCTTGAAGCTTTTCCCCCCCAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGTGTGAGGATACTCCCCTT