ORFeome > dsc3 ORF1 – XORFeome v1.0

dsc3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dsc3
Gene ID: 976997
Gene Page ID: 976993
ORF Xenbase ID: 17273145

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC089120
Original XGC clone length: 2712

Human orthology & disease relationships

NCBI Entrez ID: 1825
Ensembl gene IDs: ENSG00000134762
Directly associated (OMIM) disease MIM numbers: 613120
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11080
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ836660
dbEST ID: 79654362
Trimmed Sequence: ATGGGACTGACACTGACATCCACAGGGACGTCCCTTCTTGCCTTGTGCCTGTTACTCACCCTGCCAGTAGCTGTGTTTACAGACACATGTGAGAAAGTGAAACTGCATGTACCTTCTGTAATCTATTCTGGAAATCTGATCGGCAAAGTAAATCCTCGGCATTGTCTGGATTCAGATTCACTTATCATTCAGTCAAGCAATCCTGACTTCTTAGTTTTGGAAAATGGATCAATTTATGCGCAAAAACGTATTTCACTGGCTGGTAAAACATGGTTTACAATTCGAATCTTGGACTCCGTGACTCTGACTGAGAAAAAAATTCGAGTTAAACTGATAACCAAAGCAAAGCCTGCTAAATCAAGATATGCAAGAGAGCTACTGAGACGTTCCAAACGAAGATGGGCCCCTCTACCATTTTCTATCATGGAAAGCTATATTGGACCATTCCCATGTTTTGTACAACAGATCCAGTCTGATACACAGGAGAACTATACAATCAGATACTCTATATCAGGACCTGGCGTANATGAAGAACCCTTTGACTTGTTCTACGTTGAACCCACTACTGGAAATATATATTATAGAAGAATGGTTGATCGTGAGCAGTATCCAGTTTTTAACTTAATTGGCTTTGCAAACACGTTGGATGGCTATTCGCCAGAAGCTCCTTTAAATATAGTAATCCAAGTTTGAGAACACAATGAATATGGACCCTATATTTGTAGAAAAAACATTTTGGTATTTGAATTTTGCTGAAAACACCAAAAAAAAGGTGTTAAAAATAAGGAAAAAAGTTAAGGGGCTTTGGAAAAAAG
Full Trace Sequence: CAGGTCATAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGACTGACACTGACATCCACAGGGACGTCCCTTCTTGCCTTGTGCCTGTTACTCACCCTGCCAGTAGCTGTGTTTACAGACACATGTGAGAAAGTGAAACTGCATGTACCTTCTGTAATCTATTCTGGAAATCTGATCGGCAAAGTAAATCCTCGGCATTGTCTGGATTCAGATTCACTTATCATTCAGTCAAGCAATCCTGACTTCTTAGTTTTGGAAAATGGATCAATTTATGCGCAAAAACGTATTTCACTGGCTGGTAAAACATGGTTTACAATTCGAATCTTGGACTCCGTGACTCTGACTGAGAAAAAAATTCGAGTTAAACTGATAACCAAAGCAAAGCCTGCTAAATCAAGATATGCAAGAGAGCTACTGAGACGTTCCAAACGAAGATGGGCCCCTCTACCATTTTCTATCATGGAAAGCTATATTGGACCATTCCCATGTTTTGTACAACAGATCCAGTCTGATACACAGGAGAACTATACAATCAGATACTCTATATCAGGACCTGGCGTANATGAAGAACCCTTTGACTTGTTCTACGTTGAACCCACTACTGGAAATATATATTATAGAAGAATGGTTGATCGTGAGCAGTATCCAGTTTTTAACTTAATTGGCTTTGCAAACACGTTGGATGGCTATTCGCCAGAAGCTCCTTTAAATATAGTAATCCAAGTTTGAGAACACAATGAATATGGACCCTATATTTGTAGAAAAAACATTTTGGTATTTGAATTTTGCTGAAAACACCAAAAAAAAGGTGTTAAAAATAAGGAAAAAAGTTAAGGGGCTTTGGAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACTGACACTGACA

Sequences - 3ʹ (reverse) EST

Accession: JZ836661
dbEST ID: 79654363
Trimmed Sequence: CTTTTTTGCACAGACTTCTGCTAATGTCCTGAACTTTGGTTCTAAATTATTTAAAAAGTCCATTCTGTCCTCATCTCGAAAGTCACTGCAGCATCCAACAGATCCTGCCGCAGACCCTTTTCCTTCAAAGTTGTATGACAGAACATAATCATCTCCATGTTGTTGTTCCTCATTCTGTCCACACATGTATAATTTTTCATCAAGATGGTTGTTCATAAAACTATGCCAGTCTGTATAGTTTACTCTGTTCACATCAAAGAACTGTTGTTGTCCTCCTCCACCCATAGAAGTTAAGGTAAGGCCTCCTCGGTTATCCTCTGCAGTGTTTAGTTGCCCTGTGGTTTTTCTTGTATGGATAGTTTGTTGTATAATTTGGCTTCCACTTTGTCCTTTGCCACCTGAAACAGATGGAGCATTTCCACTACGGTGTGCATCTGTTACATGAACAGGAACTTTGAAATTTGAATCCATCACATCTGCTCCTGGTGCCTCAGTGTTGGTTACAATTAGATTCTGTTGTGCTGAATCATCAGGAAAACTTTTTTTACCCTTTGTAGCTGCGGCACCCCACAGGCAAGCACACAAACCACATAAGAACAGGGCAAAGAGTAATGCAGCCAGCACCATCACTAGAAAAAGCCCATCCCACAAGGGCCACATTGGTTGAAAAATTTAATATTACCAAACAAAGTTTTTCAATTACTAGGGGAAATAGCCAATTCCCTAATAAATTCAAAAATCCTGTGTTTTGGGCCCATATCCCTTTGGCTGA
Full Trace Sequence: GCCAGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTTTGCACAGACTTCTGCTAATGTCCTGAACTTTGGTTCTAAATTATTTAAAAAGTCCATTCTGTCCTCATCTCGAAAGTCACTGCAGCATCCAACAGATCCTGCCGCAGACCCTTTTCCTTCAAAGTTGTATGACAGAACATAATCATCTCCATGTTGTTGTTCCTCATTCTGTCCACACATGTATAATTTTTCATCAAGATGGTTGTTCATAAAACTATGCCAGTCTGTATAGTTTACTCTGTTCACATCAAAGAACTGTTGTTGTCCTCCTCCACCCATAGAAGTTAAGGTAAGGCCTCCTCGGTTATCCTCTGCAGTGTTTAGTTGCCCTGTGGTTTTTCTTGTATGGATAGTTTGTTGTATAATTTGGCTTCCACTTTGTCCTTTGCCACCTGAAACAGATGGAGCATTTCCACTACGGTGTGCATCTGTTACATGAACAGGAACTTTGAAATTTGAATCCATCACATCTGCTCCTGGTGCCTCAGTGTTGGTTACAATTAGATTCTGTTGTGCTGAATCATCAGGAAAACTTTTTTTACCCTTTGTAGCTGCGGCACCCCACAGGCAAGCACACAAACCACATAAGAACAGGGCAAAGAGTAATGCAGCCAGCACCATCACTAGAAAAAGCCCATCCCACAAGGGCCACATTGGTTGAAAAATTTAATATTACCAAACAAAGTTTTTCAATTACTAGGGGAAATAGCCAATTCCCTAATAAATTCAAAAATCCTGTGTTTTGGGCCCATATCCCTTTGGCTGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTTTGCACAGACTTCTGCTA