ORFeome > dtd2 ORF1 – XORFeome v1.0

dtd2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dtd2
Gene ID: 971367
Gene Page ID: 971363
ORF Xenbase ID: 17273187

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123366
Original XGC clone length: 507

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ837535
dbEST ID: 79655237
Trimmed Sequence: ATGGCAGAGATTAGTAGGGAAGTGACTGGCCGGATTGTTCTTCAGCAATGTTTATATGCCCAGCCTGCAAGTCAAACCTCCGGATCAGGACTCAGAGGCTGAATGGGTAGAGGTCAATAAAGGCATGGTCATCTATGTGTGCTTTTTCAAAGGAGCAGAGTCATCTGTTATTCCAAAGATGGTGAGTTCTCTACTGAGCGTGAAGCTGAGTGAGTCTGACAATGGAAAACGAGTCTCTATTCTTGATCTACCTGGTGATGTCCTCATTGTCCCTCAGGCAACACTGGGTGGAAGGGCTAAAGGTCGCTGCATGCAGTATCATTCAAATGCAGACAAAGTGCTGGCTATGGAGTTATACTCCAGCCTCATTGCTCAGTGTGAGAAGGAACTTCAAGCTCACTCAAAATGGGCAGAATCACGAGCTGTATTAAAGTATGGAACATATGGGAACAGACAGGTTCTGAAGCTTGACACTAATGGACCATATACCCACCTGCTGGAGTTCTT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAGATTAGTAGGGAAGTGACTGGCCGGATTGTTCTTCAGCAATGTTTATATGCCCAGCCTGCAAGTCAAACCTCCGGATCAGGACTCAGAGGCTGAATGGGTAGAGGTCAATAAAGGCATGGTCATCTATGTGTGCTTTTTCAAAGGAGCAGAGTCATCTGTTATTCCAAAGATGGTGAGTTCTCTACTGAGCGTGAAGCTGAGTGAGTCTGACAATGGAAAACGAGTCTCTATTCTTGATCTACCTGGTGATGTCCTCATTGTCCCTCAGGCAACACTGGGTGGAAGGGCTAAAGGTCGCTGCATGCAGTATCATTCAAATGCAGACAAAGTGCTGGCTATGGAGTTATACTCCAGCCTCATTGCTCAGTGTGAGAAGGAACTTCAAGCTCACTCAAAATGGGCAGAATCACGAGCTGTATTAAAGTATGGAACATATGGGAACAGACAGGTTCTGAAGCTTGACACTAATGGACCATATACCCACCTGCTGGAGTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTTTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCCTTATTTGGCATCCCGCTTAATAACCCCAACAGTCGGGTTGATTGCCTTNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTATTTGTGAGTTTCCAACCCCGCCGACAGAAAAAAAAAGGCGTCCTTTCCGCCAACCCCGGGGGTGCCTGGTGTACGCCACTCTGGGGGGGGGGGAGTAGAGGCCACAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAGATTAGTAGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837534
dbEST ID: 79655236
Trimmed Sequence: GAACTCCAGCAGGTGGGTATATGGTCCATTAGTGTCAAGCTTCAGAACCTGTCTGTTCCCATATGTTCCATACTTTAATACAGCTCCTGATTCTGCCCATTTTGAGTGAGCTTGAAGTTCCTTCTCACACTGAGCAATGAGGCTGGAGTATAACTCCATAGCCAGCACTTTGTCTGCATTTGAATGATACTGCATGCAGCGACCTTTAGCCCTTCCACCCAGTGTTGCCTGAGGGACAATGAGGACATCACCAGGTAGATCAAGAATAGAGACTCGTTTTCCATTGTCAGACTCACTCAGCTTCACGCTCAGTAGAGAACTCACCATCTTTGGAATAACAGATGACTCTGCTCCTTTGAAAAAGCACACATAGATGACCATGCCTTTATTGACCTCTACCCATTCAGCCTCTGAGTCCTGATCCGGAGGTTTGACTTGCAGCTTGGCATATAAACATTGCTGAAGAACAATCCGGCCAGTCACTTCCCTACTAATCTCTGCCATGG
Full Trace Sequence: CGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAACTCCAGCAGGTGGGTATATGGTCCATTAGTGTCAAGCTTCAGAACCTGTCTGTTCCCATATGTTCCATACTTTAATACAGCTCCTGATTCTGCCCATTTTGAGTGAGCTTGAAGTTCCTTCTCACACTGAGCAATGAGGCTGGAGTATAACTCCATAGCCAGCACTTTGTCTGCATTTGAATGATACTGCATGCAGCGACCTTTAGCCCTTCCACCCAGTGTTGCCTGAGGGACAATGAGGACATCACCAGGTAGATCAAGAATAGAGACTCGTTTTCCATTGTCAGACTCACTCAGCTTCACGCTCAGTAGAGAACTCACCATCTTTGGAATAACAGATGACTCTGCTCCTTTGAAAAAGCACACATAGATGACCATGCCTTTATTGACCTCTACCCATTCAGCCTCTGAGTCCTGATCCGGAGGTTTGACTTGCAGCTTGGCATATAAACATTGCTGAAGAACAATCCGGCCAGTCACTTCCCTACTAATCTCTGCCATGGTGCCGACTTTTTTGTAAAAAATTGGCATTATAAAAAAACCTTGCTCATCAATTTTCTTCAACGAACAGGTTCACTATTAGTCAAAAAAGAATCATTATTGAGAAAAAAAAAAAAAGAAAAAAACATCATTTTACACAACCCATAACAGGGGCGCGAGAAAGAAAACATCCCTTCCGGCACTCACGGGGGTGTTTGTGTGTGTGGCGTCTGGTGGGAAGGAGAAAAGGAAGGAAGAAGCACGNGGGAAAAAGGGGGGAGGAGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACTCCAGCAGGTGGGTA