ORFeome > dtna ORF1 – XORFeome v1.0

dtna ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dtna
Gene ID: 6252681
Gene Page ID: 6458118
ORF Xenbase ID: 17273205

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046265
Original XGC clone length: 2232

Human orthology & disease relationships

NCBI Entrez ID: 1837
Ensembl gene IDs: ENSG00000134769
Directly associated (OMIM) disease MIM numbers: 604169
Indirectly associated (Lage, et al.) disease MIM numbers: 253700,300376,302045,310200,601287,604169,604286,606617,606685,608099

Library Location

Plate ID: GDExl11017
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ824426
dbEST ID: 79642128
Trimmed Sequence: ATGATTGAAGACTCTGGAAAAAGGGGGAATACCATGGCAGAACGAAGGCAGTTGTTTGCAGAAATGCGTGCTCAAGATTTGGATCGGATTCGCTTGTCTACATACCGAACTGCCTGCAAGCTTCGGTTTGTGCAGAAAAAATGCAACTTGCATCTGGTGGATATCTGGAACATTATAGAAGCGTTGCGGGAAAATTCACTAAACAATGTGGACCCAAACGTGGAACTGAATGTGGCTCGCTTGGAAGCGGTGCTCTCAACGATTTTTTACCAGCTAAATAAGAGGATGCCAACTACTCATCAGATCAACGTAGAACAATCAATCAGCCTAATGTTAAACTTCCTACTCGCTGCTTATGATTCGGAAGGGCATGGTAAGATTACAGTTTTCGCTGTCAAAATGGCTCTAGCAACTTTATGCGGAGGAAAAATTATGGACAAATTAAGATATATTTACTCCATGATATCTGATGCAAATGGGGTTATGGTATCTGGATGCTATGATCAATTTCTAAGAGAGGTCCTAAAATTGCCCACTGCAATTTTTGAGGGCCCTTCATTTGGTTACACAGAGCAAGCTGCCAGGTCCTGTTTTTCACAACAGAAAAAAGTTACCTTAAACTCTTTCCTGGATACACTTATGTCTGACCCACCACCTCAGTGTCTTGTCTGGTTACCTCTTCTGCATAGACTGGCGAATGTAGAAAATGTCTTCCCATCCTGTGAGTGTTCCTATTGCCACAGTGAGAAGTATGGATGGGTTTTCCGTTATCGGCTGGCCACCAAGTGTCCCAATTACCCAGCCTTTGGTCCGGGATTG
Full Trace Sequence: GCCAATACTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTGAAGACTCTGGAAAAAGGGGGAATACCATGGCAGAACGAAGGCAGTTGTTTGCAGAAATGCGTGCTCAAGATTTGGATCGGATTCGCTTGTCTACATACCGAACTGCCTGCAAGCTTCGGTTTGTGCAGAAAAAATGCAACTTGCATCTGGTGGATATCTGGAACATTATAGAAGCGTTGCGGGAAAATTCACTAAACAATGTGGACCCAAACGTGGAACTGAATGTGGCTCGCTTGGAAGCGGTGCTCTCAACGATTTTTTACCAGCTAAATAAGAGGATGCCAACTACTCATCAGATCAACGTAGAACAATCAATCAGCCTAATGTTAAACTTCCTACTCGCTGCTTATGATTCGGAAGGGCATGGTAAGATTACAGTTTTCGCTGTCAAAATGGCTCTAGCAACTTTATGCGGAGGAAAAATTATGGACAAATTAAGATATATTTACTCCATGATATCTGATGCAAATGGGGTTATGGTATCTGGATGCTATGATCAATTTCTAAGAGAGGTCCTAAAATTGCCCACTGCAATTTTTGAGGGCCCTTCATTTGGTTACACAGAGCAAGCTGCCAGGTCCTGTTTTTCACAACAGAAAAAAGTTACCTTAAACTCTTTCCTGGATACACTTATGTCTGACCCACCACCTCAGTGTCTTGTCTGGTTACCTCTTCTGCATAGACTGGCGAATGTAGAAAATGTCTTCCCATCCTGTGAGTGTTCCTATTGCCACAGTGAGAAGTATGGATGGGTTTTCCGTTATCGGCTGGCCACCAAGTGTCCCAATTACCCAGCCTTTGGTCCGGGATTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTGAAGACTCTGGAAAAAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829783
dbEST ID: 79647485
Trimmed Sequence: GCCCTGCAAACTGACCTGATAAGCTTCATCTTGTAACTTCTGCTTTAAATACTCTTCCATCTTCAGCTCATGCTCTAACTGGCGCACAGAGTCATTTTCATAAGTCTCAGCATCATGCCTGCCGTAGGAGTCCCCTGGGCCCATGTCAGTGCGAATGTTGCCAGTAGCAGCAGAATGATGATTAAACCCCGGTTTTCGAGCATGGATCTGGGCAAGGAAGGCCTTCTCTGAGGTTGGTGATGGAACCAAATCATCAAAATGAACCCGTCCATATTCAGTTTCCACACCACACTCTGTTTCATTTCCAACATCTGACTTCAGCTCTTTAACCAGAGAAGACATAGTATTGGTAATTGAATCAGCTGCTACAAGTAAATCATTCCGTAAATTTCTCCTTGTGCTCTGAGCAAAAGCTTCTTGCACATCTCCCCCAACACCAGTCAGAGAATCCTGAGGAGTGTGGGTTGGGGGTGGAGCAGGCAGATACTGAGCGAATAGGCATAGGTATAGGTCGGCTAATGGTATGACTAGGAGATGAGCGAGGGGAACCAGCCCCCTGAGTTTCCTGTCGCAGCTCTTGCTCCTTTAGAAGTTTCATAAGCCCTTCAAGCTGCACCATCAACTCCCTCCTGCTCTCCTGNCAGGCAGACATCCTCTGCTCAAGTTCATCTTTGCGTTGTCTGAAGGATCGAAGTCAACAAGGAAGGGTGGGGATCCGGTTTTTGCCTTTGTTCCGGGCTGGGGGCTGGTGAAAGGCCCGGTTCATGTT
Full Trace Sequence: TGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCCTGCAAACTGACCTGATAAGCTTCATCTTGTAACTTCTGCTTTAAATACTCTTCCATCTTCAGCTCATGCTCTAACTGGCGCACAGAGTCATTTTCATAAGTCTCAGCATCATGCCTGCCGTAGGAGTCCCCTGGGCCCATGTCAGTGCGAATGTTGCCAGTAGCAGCAGAATGATGATTAAACCCCGGTTTTCGAGCATGGATCTGGGCAAGGAAGGCCTTCTCTGAGGTTGGTGATGGAACCAAATCATCAAAATGAACCCGTCCATATTCAGTTTCCACACCACACTCTGTTTCATTTCCAACATCTGACTTCAGCTCTTTAACCAGAGAAGACATAGTATTGGTAATTGAATCAGCTGCTACAAGTAAATCATTCCGTAAATTTCTCCTTGTGCTCTGAGCAAAAGCTTCTTGCACATCTCCCCCAACACCAGTCAGAGAATCCTGAGGAGTGTGGGTTGGGGGTGGAGCAGGCAGATACTGAGCGAATAGGCATAGGTATAGGTCGGCTAATGGTATGACTAGGAGATGAGCGAGGGGAACCAGCCCCCTGAGTTTCCTGTCGCAGCTCTTGCTCCTTTAGAAGTTTCATAAGCCCTTCAAGCTGCACCATCAACTCCCTCCTGCTCTCCTGNCAGGCAGACATCCTCTGCTCAAGTTCATCTTTGCGTTGTCTGAAGGATCGAAGTCAACAAGGAAGGGTGGGGATCCGGTTTTTGCCTTTGTTCCGGGCTGGGGGCTGGTGAAAGGCCCGGTTCATGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCCTGCAAACTGACCT