ORFeome > dtnbp1 ORF1 – XORFeome v1.0

dtnbp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dtnbp1
Gene ID: 5812171
Gene Page ID: 5812146
ORF Xenbase ID: 17273217

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081232
Original XGC clone length: 1065

Human orthology & disease relationships

NCBI Entrez ID: 84062
Ensembl gene IDs: ENSG00000047579
Directly associated (OMIM) disease MIM numbers: 181500,614076
Indirectly associated (Lage, et al.) disease MIM numbers: 203300

Library Location

Plate ID: GDExl11004
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ839592
dbEST ID: 79657294
Trimmed Sequence: ATGTTTGAAAGCCTGCGGGAGCGGCTGCTCAGTGTTCAGCAGGACTTCACCAGCGGGCTAAAGAGTTTAGGGGATAAGTCAAGAGAAGTGAAAATAAAAAAGCAATACAGGCAAGCTGAGCAGCTCTCAAAGTTTCCTGCTGGAGCAGAACTCCTTCGCAGGTACGAAGATACCTGGGCTGCACTCCACAAAGTAGCAAGCGATTGTGCTAAAGCTGGAGAGCAGGTAGATGNGGGAGGTTGTGATGCTATCAGCACACTGGGAGAAAAAGAGGAATAGTCTTGTAGAACTGCAGGAACAGTTGCAACAAGTGCCAGGATTTGTAGCAGATCTGGAATCTGTTACAGCAAAATTAGTTGCACTGGAAGGAAGCTTTGAAGATGTTGAAAGATGCCTGTTGGAACTTGAAGACATGTGTGAACAGTGTGAATTACAGAGATTTAAGCATGTGCAATACATGCAGCTAGAGCAATACAAGAAAAGCAAAAGGAAAGAACTTGAAAACTTTAAAGCTGAGCTGGATGCAGAGCATACTCAGAGGGTGCTGGATGTGGAGCATTCCCAGCAGATGAAGCTGAAAGAGAGACAGAGGTTCTTTGAAGAAGCTTTCCAACAAAATATGGAGCAGTATCTTTCGAGTGGCTATCTGCAGATATCAGAAAGAAAGAGCCAATTGGAAGTATGTCGNTCATGGAAGTCAATGTAGACATGTTTGGAGCAGATGGACCTGATGGGAATGTCAGACCAAAAAAACGCTTGATGTTTTTCTTGGATTCCGGACCCAAAAGGAAAAAAGTGGTTCCTTTCTCCAATTTTTAAAGGG
Full Trace Sequence: GGGGGCCCCTATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTGAAAGCCTGCGGGAGCGGCTGCTCAGTGTTCAGCAGGACTTCACCAGCGGGCTAAAGAGTTTAGGGGATAAGTCAAGAGAAGTGAAAATAAAAAAGCAATACAGGCAAGCTGAGCAGCTCTCAAAGTTTCCTGCTGGAGCAGAACTCCTTCGCAGGTACGAAGATACCTGGGCTGCACTCCACAAAGTAGCAAGCGATTGTGCTAAAGCTGGAGAGCAGGTAGATGNGGGAGGTTGTGATGCTATCAGCACACTGGGAGAAAAAGAGGAATAGTCTTGTAGAACTGCAGGAACAGTTGCAACAAGTGCCAGGATTTGTAGCAGATCTGGAATCTGTTACAGCAAAATTAGTTGCACTGGAAGGAAGCTTTGAAGATGTTGAAAGATGCCTGTTGGAACTTGAAGACATGTGTGAACAGTGTGAATTACAGAGATTTAAGCATGTGCAATACATGCAGCTAGAGCAATACAAGAAAAGCAAAAGGAAAGAACTTGAAAACTTTAAAGCTGAGCTGGATGCAGAGCATACTCAGAGGGTGCTGGATGTGGAGCATTCCCAGCAGATGAAGCTGAAAGAGAGACAGAGGTTCTTTGAAGAAGCTTTCCAACAAAATATGGAGCAGTATCTTTCGAGTGGCTATCTGCAGATATCAGAAAGAAAGAGCCAATTGGAAGTATGTCGNTCATGGAAGTCAATGTAGACATGTTTGGAGCAGATGGACCTGATGGGAATGTCAGACCAAAAAAACGCTTGATGTTTTTCTTGGATTCCGGACCCAAAAGGAAAAAAGTGGTTCCTTTCTCCAATTTTTAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTGAAAGCCTGCGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839591
dbEST ID: 79657293
Trimmed Sequence: TGCCGTGTGAGCATCACTTTCATCACTGACGTCTGAAGTCACGTTTGCAACGGTGTCTAGGCCAGTAAGAACAGAGTCCGCCTGAACATCTTCATCATCTGATTGGATAACTGGTGACTCTCCCCCATCTTCGCTATTCTCTGGGCTGGCAGAGTCGGTGCATGTAGAAGACAGCGAAGAGAGTTTGTGTCTCAGTTCAGCCTGGCTGGGAACCTGCAGGGTTATCTCATTTTGGCAATCAAACTCCGGGCCTATAATAGGAGAAAGAACACTGTTCTCCTCTGCTCCGGAATTCAAGAAAACATCAAGCGCTTCTTGGTCTGACATGTCCATCAGGTCCATCTGCTCCAACATGTCTACATTGACTTCCATTGACGACATACTTCCAATTGGCTCTCTTCTTTCTGATATCTGCAGATAGCCACTCGAAAGATACTGCTCCATATCTTGTTGGAAAGCTTCTTCAAAGAACCTCTGTCTCTCTTTCAGCTTCATCTGCTGGGAATGCTCCACATCCAGCACCCTCTGAGTATGCTCTGCATCCAGCTCAGCTTTAAAGTTTTCAAGTTCTTTCCTTTTGCTTTTCTTGTATTGCTCTAGCTGCATGTATTGCACATGCTTAAATCTCTGTAATTCACACTGTTTCAACATGTCTTTCAATTTCCAACAGGCATCTTTCACCATCTTTCAAAGCTTCCTTTCCATTGCAACCTAATTTTGCCTGTAAAAAAATCCAGAAATTTGCCTAACAAATCCCGGGGCCCTTGGTTGGCCACCG
Full Trace Sequence: GGGGAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCCGTGTGAGCATCACTTTCATCACTGACGTCTGAAGTCACGTTTGCAACGGTGTCTAGGCCAGTAAGAACAGAGTCCGCCTGAACATCTTCATCATCTGATTGGATAACTGGTGACTCTCCCCCATCTTCGCTATTCTCTGGGCTGGCAGAGTCGGTGCATGTAGAAGACAGCGAAGAGAGTTTGTGTCTCAGTTCAGCCTGGCTGGGAACCTGCAGGGTTATCTCATTTTGGCAATCAAACTCCGGGCCTATAATAGGAGAAAGAACACTGTTCTCCTCTGCTCCGGAATTCAAGAAAACATCAAGCGCTTCTTGGTCTGACATGTCCATCAGGTCCATCTGCTCCAACATGTCTACATTGACTTCCATTGACGACATACTTCCAATTGGCTCTCTTCTTTCTGATATCTGCAGATAGCCACTCGAAAGATACTGCTCCATATCTTGTTGGAAAGCTTCTTCAAAGAACCTCTGTCTCTCTTTCAGCTTCATCTGCTGGGAATGCTCCACATCCAGCACCCTCTGAGTATGCTCTGCATCCAGCTCAGCTTTAAAGTTTTCAAGTTCTTTCCTTTTGCTTTTCTTGTATTGCTCTAGCTGCATGTATTGCACATGCTTAAATCTCTGTAATTCACACTGTTTCAACATGTCTTTCAATTTCCAACAGGCATCTTTCACCATCTTTCAAAGCTTCCTTTCCATTGCAACCTAATTTTGCCTGTAAAAAAATCCAGAAATTTGCCTAACAAATCCCGGGGCCCTTGGTTGGCCACCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCGTGTGAGCATCACTT