ORFeome > dus3l ORF1 – XORFeome v1.0

dus3l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dus3l
Gene ID: 943243
Gene Page ID: 943236
ORF Xenbase ID: 17273259

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046730
Original XGC clone length: 1923

Human orthology & disease relationships

NCBI Entrez ID: 56931
Ensembl gene IDs: ENSG00000141994
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 188550,231550

Library Location

Plate ID: GDExl11012
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ823991
dbEST ID: 79641693
Trimmed Sequence: ATGGCAGAAAGTGAAGGCTCGAATACTGAAAATGGCAAAGTGGGTGCCGTAAAATCTGAAAATCTGGACCGTGGTGTAGCAGCCATTAAAAACCAATTTCTGACCACCAAAGAGAAGTTTCATGCTTTCATCGATGCTGATGGAAAGGACGTTACAGAAAAGGAAACTTGTTCAGAGCTGTCTCTTAATGATGCAGAGAACACGACCCGTACCGAGAATGCAGCAGAACCTGAAGCAAAACGAATTAAGCTTGATGATGGGAGTAGTGAAGGCCAGGACCAACCCCCCAAGACTGCAGAGAACAAGCAAGAAAAGAAAAGAGCCAGAGGACAGAACAAAAGTCGACCTCACATGAAACATTCCCAGTTTGAAGAAAATAAACTGTGTCCATCAGTTACTCAGGAATGTGCCAGTAAATGTTTTTTTGGAGACAAATGCAAGTTTTCGCACGATGTTGCCAAATATGTATCACAAAAGCCAGAGGATATTCGCCCAAACTGTCACCTGTATGAGACTTTTGGGAAGTGCATTTATGGAGTCACATGTCGGTTCGCCAAATCACACCTGGGGGAGGATTTTAAGAACATAATTAATGAAGAGCTTATGAAGGAGTGGGAAGGCAAAGTATTGGTGAAAAACAGCCTAGACAAAAGCTTAAAGGAACAGTTACGAAAAAAGAAAGTTGTGTTTGAGAAATCCGATAAATATTTAAAGCTTTTGCTTCAATCTGGAGACAGTTCAAAAAATGAAGAACCCAGGTAATTTAAGGAAGACAGCCGGCTGTGCCAAGTTACCACCAAAAAGGAAAAATC
Full Trace Sequence: CATTATTGATTTTATTTTAGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAAGTGAAGGCTCGAATACTGAAAATGGCAAAGTGGGTGCCGTAAAATCTGAAAATCTGGACCGTGGTGTAGCAGCCATTAAAAACCAATTTCTGACCACCAAAGAGAAGTTTCATGCTTTCATCGATGCTGATGGAAAGGACGTTACAGAAAAGGAAACTTGTTCAGAGCTGTCTCTTAATGATGCAGAGAACACGACCCGTACCGAGAATGCAGCAGAACCTGAAGCAAAACGAATTAAGCTTGATGATGGGAGTAGTGAAGGCCAGGACCAACCCCCCAAGACTGCAGAGAACAAGCAAGAAAAGAAAAGAGCCAGAGGACAGAACAAAAGTCGACCTCACATGAAACATTCCCAGTTTGAAGAAAATAAACTGTGTCCATCAGTTACTCAGGAATGTGCCAGTAAATGTTTTTTTGGAGACAAATGCAAGTTTTCGCACGATGTTGCCAAATATGTATCACAAAAGCCAGAGGATATTCGCCCAAACTGTCACCTGTATGAGACTTTTGGGAAGTGCATTTATGGAGTCACATGTCGGTTCGCCAAATCACACCTGGGGGAGGATTTTAAGAACATAATTAATGAAGAGCTTATGAAGGAGTGGGAAGGCAAAGTATTGGTGAAAAACAGCCTAGACAAAAGCTTAAAGGAACAGTTACGAAAAAAGAAAGTTGTGTTTGAGAAATCCGATAAATATTTAAAGCTTTTGCTTCAATCTGGAGACAGTTCAAAAAATGAAGAACCCAGGTAATTTAAGGAAGACAGCCGGCTGTGCCAAGTTACCACCAAAAAGGAAAAATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAAGTGAAGGCTCGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829299
dbEST ID: 79647001
Trimmed Sequence: TTTATAAGAGTTGGCTTTGTGCTTTGGCAGAAAGGTGAAGTTCGGAGGAACAGGTCCCAAAAGCATCTCACTTATTTTTATCCAGTCCGTTACGTTCTGACTTGCCATTAAAGTCTCCAAGTAGTCTCTCCCCATGTAGTATGGAGGCCTTTCATTTATCTTCTGAGGTACATGCTCCAGTAAACCAACGGGAATATACCTGCATAAAAAGGATAGCCACTCCAGCATGAATTTTCTTGTTTTCTCAACCCCCTGGCAATCTGAACCCCAGTGTTCCAGGCCGTAATTTGTAAAGTCCTTTAAGATGTCAAATCGTTCCGTTGAGGAAATATCCCAGTGCCGCTGCTCTTTAATTTCAGTAAACAGCCATGGCTTGAATAACGCTCCTCTTGCCAACATCACTCCTGCAACTCCAGTCTGCAAAGCTCGATTTGCATCCTCATAGGATATGATGTCTCCATTGCCAAACAAGGGGACAGGACTTGCTATTTTCGCACACTGATCTATGTATTCCCAGTTTGCTAGTTTTGTGTATCGTTGTTCTCTGGATCTTCCATGAAGTGTAACCAATGAGACTCCCCAGTCTCTGAGATTCGGAAATAGTTTGTGGGCAATGTTGACTTTTTCTTGCACCCCAGTCCTGATTTTTACGGTCAATGGAAACATCAGGGACAGAATCATCCTTTTCACGATCTGGTTCAATTTAATTAGATCCTGTTCCATTAAGCCACCAACCCCCCCCCCCCTTTTTTGTTTCCCCCCAAAAC
Full Trace Sequence: GGACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTATAAGAGTTGGCTTTGTGCTTTGGCAGAAAGGTGAAGTTCGGAGGAACAGGTCCCAAAAGCATCTCACTTATTTTTATCCAGTCCGTTACGTTCTGACTTGCCATTAAAGTCTCCAAGTAGTCTCTCCCCATGTAGTATGGAGGCCTTTCATTTATCTTCTGAGGTACATGCTCCAGTAAACCAACGGGAATATACCTGCATAAAAAGGATAGCCACTCCAGCATGAATTTTCTTGTTTTCTCAACCCCCTGGCAATCTGAACCCCAGTGTTCCAGGCCGTAATTTGTAAAGTCCTTTAAGATGTCAAATCGTTCCGTTGAGGAAATATCCCAGTGCCGCTGCTCTTTAATTTCAGTAAACAGCCATGGCTTGAATAACGCTCCTCTTGCCAACATCACTCCTGCAACTCCAGTCTGCAAAGCTCGATTTGCATCCTCATAGGATATGATGTCTCCATTGCCAAACAAGGGGACAGGACTTGCTATTTTCGCACACTGATCTATGTATTCCCAGTTTGCTAGTTTTGTGTATCGTTGTTCTCTGGATCTTCCATGAAGTGTAACCAATGAGACTCCCCAGTCTCTGAGATTCGGAAATAGTTTGTGGGCAATGTTGACTTTTTCTTGCACCCCAGTCCTGATTTTTACGGTCAATGGAAACATCAGGGACAGAATCATCCTTTTCACGATCTGGTTCAATTTAATTAGATCCTGTTCCATTAAGCCACCAACCCCCCCCCCCCTTTTTTGTTTCCCCCCAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTATAAGAGTTGGCTTTGTGCTT