ORFeome > dusp12 ORF1 – XORFeome v1.0

dusp12 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dusp12
Gene ID: 5900138
Gene Page ID: 5900066
ORF Xenbase ID: 17273277

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123261
Original XGC clone length: 918

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ838821
dbEST ID: 79656523
Trimmed Sequence: ATGATCTGTGTCTTGCCTGGGTTGTACCTTGGCAGCGCCAGCGATGCTGCTGATGTGCAAAGACTACAAGAGGCTGGTATCACACACGTGCTGACAGTGGACAGTGAAGCGCCAAACGGGCTGGATGGGTTCATTACAAAGTTTGTTCATTTATTGGATGATGCCAGCGCAGACCTCCTGAGTTGTTTGCCTGCTTGTACAGACTTCTTGAAAGAGGCTTTGGGGAAATCTGGTTTATCTGTACTTGTTCACTGCCATGCTGGGGTGAGCAGAAGTGCCGCAGTCATCACATCCTATTTGATGCACACCTCCAGACTTTCCTTGGAAGATGCTTGCTCAAGGCTACAGGCTCTGAAAACGGACATCAAGATGAATGAGGAGTTTCTTGGCCAGCTCTCCCTTTATGAAGCAATGGGCTGTGATGTGGACATGACCTGTGCAAGCTACAAACAATATCTCCTGCAGATAGTCACAGAGAAGTACCCAGAGCTACGGAAGCTGCCGCGAAAAATCTTTTGCTTCTGACCCTTGTTCCATGGGCCGAGACTGCAAAAGTTCTCTACCACGTTAAGGGAATGAAGGCGCTCCTTTGTTCAGGGAAGGCGGTATCCTTAAACATGCCTTAGGCACTGCAATTCTGCATTTGCTACGAACGGTTGGGCTCGATACCAAAACCGAAACCGACCAAATGCGCCTCGCATTTTTTTGAAGACCCGTTCAAAGGAAGGCAAAAACTCTTATCTGGTGCGTTGTGGGTGGGAAAGGTTTCGGGCCCCCAAAAGTAGACGCCGAAAATAGTTGAGCGGTTTCCCCCGCTGCGGA
Full Trace Sequence: CTCGTGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCTGTGTCTTGCCTGGGTTGTACCTTGGCAGCGCCAGCGATGCTGCTGATGTGCAAAGACTACAAGAGGCTGGTATCACACACGTGCTGACAGTGGACAGTGAAGCGCCAAACGGGCTGGATGGGTTCATTACAAAGTTTGTTCATTTATTGGATGATGCCAGCGCAGACCTCCTGAGTTGTTTGCCTGCTTGTACAGACTTCTTGAAAGAGGCTTTGGGGAAATCTGGTTTATCTGTACTTGTTCACTGCCATGCTGGGGTGAGCAGAAGTGCCGCAGTCATCACATCCTATTTGATGCACACCTCCAGACTTTCCTTGGAAGATGCTTGCTCAAGGCTACAGGCTCTGAAAACGGACATCAAGATGAATGAGGAGTTTCTTGGCCAGCTCTCCCTTTATGAAGCAATGGGCTGTGATGTGGACATGACCTGTGCAAGCTACAAACAATATCTCCTGCAGATAGTCACAGAGAAGTACCCAGAGCTACGGAAGCTGCCGCGAAAAATCTTTTGCTTCTGACCCTTGTTCCATGGGCCGAGACTGCAAAAGTTCTCTACCACGTTAAGGGAATGAAGGCGCTCCTTTGTTCAGGGAAGGCGGTATCCTTAAACATGCCTTAGGCACTGCAATTCTGCATTTGCTACGAACGGTTGGGCTCGATACCAAAACCGAAACCGACCAAATGCGCCTCGCATTTTTTTGAAGACCCGTTCAAAGGAAGGCAAAAACTCTTATCTGGTGCGTTGTGGGTGGGAAAGGTTTCGGGCCCCCAAAAGTAGACGCCGAAAATAGTTGAGCGGTTTCCCCCGCTGCGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCTGTGTCTTGCCTGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838820
dbEST ID: 79656522
Trimmed Sequence: TGTGTTGCTTTGCTGTATGCCTCGGATATGTCGATTTTTCGCCTCGTCTACTCTGTTCTTATGGATCTGGAAAGCAGGAGTAACCCATCGACCACACGAGCATTGTACTCCATACCAGTTGAAGGAGCCCAACTTAGAGCTACATTTTGGGCAGAGAAGCTGTCCATCCATAACCCCCAGCAGAGCTTCTGCCATCCACTGAACGGGCTCCACAAAATAGGAGGTGCACTTTGTGGTGTCTGCTTTCTGTATTGAGGGCAACCGTTTGTGAGCAAATGCAGCAGTGCCAGTGCCTAAGGCATGATTCAGGATACTGCCCTCCCTGAACAAGGAGCGCCTGCATTTCCTACACCTGTAGAGAACCTCTGCAGTCTGGGCCATGGAACAAGGGTCAGAAGCAAAGACTTCTTGGGGCAGCTTCCGTAGCTCTGGGTACTTCTCTGTGACTTTCTGCAGGCGATATTGTTTGTAGCTTGCACAGGTCATGTCCACATCACAGCCCATTGCTTCATAAAGGGAGAGCTGGCCGAGAAACTCCTCATTCATCTTGATGTCCGTTTTCAGAGCCTGTAGCCTTGAGCAAGCATCTTCCAAGGAAAGTCTGGAGGTGTGCATGCAATAAGATGTGATGACTGCGGCACCTCTGCTCACCCCAGCATGGCCGGTGAACAAGTACAAATAAACCAAAAATTCCCCAAACCCTCTTTTCCAAAAAGTCGGGTCCAACCAGGCCAAACCAACTCAGGGAGGTTCGTCGCCTTTGACGCGTGCCC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTGTTGCTTTGCTGTATGCCTCGGATATGTCGATTTTTCGCCTCGTCTACTCTGTTCTTATGGATCTGGAAAGCAGGAGTAACCCATCGACCACACGAGCATTGTACTCCATACCAGTTGAAGGAGCCCAACTTAGAGCTACATTTTGGGCAGAGAAGCTGTCCATCCATAACCCCCAGCAGAGCTTCTGCCATCCACTGAACGGGCTCCACAAAATAGGAGGTGCACTTTGTGGTGTCTGCTTTCTGTATTGAGGGCAACCGTTTGTGAGCAAATGCAGCAGTGCCAGTGCCTAAGGCATGATTCAGGATACTGCCCTCCCTGAACAAGGAGCGCCTGCATTTCCTACACCTGTAGAGAACCTCTGCAGTCTGGGCCATGGAACAAGGGTCAGAAGCAAAGACTTCTTGGGGCAGCTTCCGTAGCTCTGGGTACTTCTCTGTGACTTTCTGCAGGCGATATTGTTTGTAGCTTGCACAGGTCATGTCCACATCACAGCCCATTGCTTCATAAAGGGAGAGCTGGCCGAGAAACTCCTCATTCATCTTGATGTCCGTTTTCAGAGCCTGTAGCCTTGAGCAAGCATCTTCCAAGGAAAGTCTGGAGGTGTGCATGCAATAAGATGTGATGACTGCGGCACCTCTGCTCACCCCAGCATGGCCGGTGAACAAGTACAAATAAACCAAAAATTCCCCAAACCCTCTTTTCCAAAAAGTCGGGTCCAACCAGGCCAAACCAACTCAGGGAGGTTCGTCGCCTTTGACGCGTGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTGTTGCTTTGCTGTATGCCT