ORFeome > dusp6 ORF1 – XORFeome v1.0

dusp6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dusp6
Gene ID: 978223
Gene Page ID: 978215
ORF Xenbase ID: 17273319

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059985
Original XGC clone length: 1137

Human orthology & disease relationships

NCBI Entrez ID: 1848
Ensembl gene IDs: ENSG00000139318
Directly associated (OMIM) disease MIM numbers: 615269
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ824476
dbEST ID: 79642178
Trimmed Sequence: ATGCTAGAGAAGTTGAGACCCGCTGCGCCCTTGGACATGGCGCTCGGTAAATCGGTGTCGTGGCTGAACGAGCAGCTGGACGTGGCCAACGAGCGGCTTCTTCTGATGGACTGCAGGGCGCACGAGCTGTACGAGTCGTCTCACATCGAGGCGGCCATGAACGTGGCCATCCCGGGCATCATGCTGCGCCGCCTCAAGAAGGGAAACCTGCCCATCCGGTCGCTCTTTGCCTGCGGGGAGGACCGGGACAAGTTCGCCCGCCGATGCGGCACCGACACGGTTGTACTGTACGACGAGAACAGCTGCGACTGGAACGAGAACACGGCCGGCGAGTCGGTGCTGGGGCTGCTCATGAAGCGGCTGAAGGACGAGGGCTGCAGGGCTTTCTACCTGGAAGGTGGATTCAACAAGTTCCAATCTGAGTATCCTATACATTGTGAAACCAATCTGGATAGTTCCTGTAGCAGTAGCTCTCCACCCGTCCTTGGTTTGGGAGGCCTCCGGATCAGTTCTGACTCTTCGTCAGATATTGAATCTGACATTGACAGGGATCCCAGCAGTGCAACAGATTCAGACGGTAGTCCTCTATCCAACCCTCAGCCATCATTTCCCGTTGAGATCTTACCCTACCTTTACCTCGGTTGTGCTAAGGATTCTACTAACCTGGATGTTTTGGAAGAGTTTGGCATTAAGTACATACTGAACGTGACACCAAACTTGCCTAATCTTTTTGAAAACCCGGGGGAGTTTAGATACAAGCAGAATCCCCATTTCGGAACATTGGAAACCCAAAACCTGGT
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTAGAGAAGTTGAGACCCGCTGCGCCCTTGGACATGGCGCTCGGTAAATCGGTGTCGTGGCTGAACGAGCAGCTGGACGTGGCCAACGAGCGGCTTCTTCTGATGGACTGCAGGGCGCACGAGCTGTACGAGTCGTCTCACATCGAGGCGGCCATGAACGTGGCCATCCCGGGCATCATGCTGCGCCGCCTCAAGAAGGGAAACCTGCCCATCCGGTCGCTCTTTGCCTGCGGGGAGGACCGGGACAAGTTCGCCCGCCGATGCGGCACCGACACGGTTGTACTGTACGACGAGAACAGCTGCGACTGGAACGAGAACACGGCCGGCGAGTCGGTGCTGGGGCTGCTCATGAAGCGGCTGAAGGACGAGGGCTGCAGGGCTTTCTACCTGGAAGGTGGATTCAACAAGTTCCAATCTGAGTATCCTATACATTGTGAAACCAATCTGGATAGTTCCTGTAGCAGTAGCTCTCCACCCGTCCTTGGTTTGGGAGGCCTCCGGATCAGTTCTGACTCTTCGTCAGATATTGAATCTGACATTGACAGGGATCCCAGCAGTGCAACAGATTCAGACGGTAGTCCTCTATCCAACCCTCAGCCATCATTTCCCGTTGAGATCTTACCCTACCTTTACCTCGGTTGTGCTAAGGATTCTACTAACCTGGATGTTTTGGAAGAGTTTGGCATTAAGTACATACTGAACGTGACACCAAACTTGCCTAATCTTTTTGAAAACCCGGGGGAGTTTAGATACAAGCAGAATCCCCATTTCGGAACATTGGAAACCCAAAACCTGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTAGAGAAGTTGAGACC

Sequences - 3ʹ (reverse) EST

Accession: JZ829830
dbEST ID: 79647532
Trimmed Sequence: CGTGGACTGCATAGAATCAACTTGATATACATTTTGGTTGGCTGGATTTGTAAAATATAACTGCTGAGCTGGGACTCGATTGTCACATGGACTGCTAAGCCCCAATGTCCTTTCAAAATCCAGCAACTGACCCATGAAGTTAAAGTTAGGAGAGATGTTGGATTTCTTCATCTTGACAATATCGTAGGCATCATTCATGGAGAGGTTCAGCTTCTGCATCAAATAAGCTACAGTGACTGTAACCGATCGGCTGATGCCGGCCAAGCAATGCACCAATACTCCACAGCTTTTACCCCGGGCTTCATCTATAAACGAGATGGCTTCTGGAAAAAACTGAGACAGGTTTTGGCTCCAATGGTCCGAAATGGGAATCTGCTTGTATCTAAATTCCCCCGCGTTTTCAAAAAGATTAGGCAAGTTTGGTGTCACGTTCAGTATGTACTTAATGCCAAACTCTTCCAAAACATCCAGGTTAGTAGAATCCTTAGCACAACCGAGGTAAAGGTAGGGTAAGATCTCAACGGGAAATGATGGCTGAGGGTTGGATAGAGGACTACCGTCTGAATCTGTTGCACTGCTGGGATCCCTGTCAATGTCAGATTCAATATCTGACGAAGAGTCAGAACTGATCCGGAGGCCTCCAAACCCANGACGGGTGGAGAGCTACTGCTACAGGAACTAATCAGAATGGGTTTCACAATGTATAGGGATACTCCAAAATGGAAACTTGGTTGAAACCCACCTTTCCCGGGTAAAAAAAGCCCCTGGC
Full Trace Sequence: GACAGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGTGGACTGCATAGAATCAACTTGATATACATTTTGGTTGGCTGGATTTGTAAAATATAACTGCTGAGCTGGGACTCGATTGTCACATGGACTGCTAAGCCCCAATGTCCTTTCAAAATCCAGCAACTGACCCATGAAGTTAAAGTTAGGAGAGATGTTGGATTTCTTCATCTTGACAATATCGTAGGCATCATTCATGGAGAGGTTCAGCTTCTGCATCAAATAAGCTACAGTGACTGTAACCGATCGGCTGATGCCGGCCAAGCAATGCACCAATACTCCACAGCTTTTACCCCGGGCTTCATCTATAAACGAGATGGCTTCTGGAAAAAACTGAGACAGGTTTTGGCTCCAATGGTCCGAAATGGGAATCTGCTTGTATCTAAATTCCCCCGCGTTTTCAAAAAGATTAGGCAAGTTTGGTGTCACGTTCAGTATGTACTTAATGCCAAACTCTTCCAAAACATCCAGGTTAGTAGAATCCTTAGCACAACCGAGGTAAAGGTAGGGTAAGATCTCAACGGGAAATGATGGCTGAGGGTTGGATAGAGGACTACCGTCTGAATCTGTTGCACTGCTGGGATCCCTGTCAATGTCAGATTCAATATCTGACGAAGAGTCAGAACTGATCCGGAGGCCTCCAAACCCANGACGGGTGGAGAGCTACTGCTACAGGAACTAATCAGAATGGGTTTCACAATGTATAGGGATACTCCAAAATGGAAACTTGGTTGAAACCCACCTTTCCCGGGTAAAAAAAGCCCCTGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGTGGACTGCATAGAATCAA