ORFeome > dync1li2 ORF1 – XORFeome v1.0

dync1li2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dync1li2
Gene ID: 866282
Gene Page ID: 493713
ORF Xenbase ID: 17273361

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122488
Original XGC clone length: 1464

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ838067
dbEST ID: 79655769
Trimmed Sequence: ATGGCGGGGGAGAGGAAGCTGCTGGGCGCTGACCGGGGGGATACTCCCGGAGCAGGCGACGAAGAAGACGAAGGGCAGAGCTTATGGTCTTCTATTCTCAGTGATGTTTCCACAAGCGCAAGATCGAAGTTACCCTCTGGGAAAAACATACTGGTATTTGGTGAAGATGGTTCAGGAAAGACCACTCTCATGGCAAAACTTCAAGGTGCCGAACACAACAAGAAAGGAAGGGGGCTTGAATATTTATACTTGAACATTCATGATGAAGATAGAGATGATCTCACACGTTGCAATGTGTGGATTTTGGATGGGGACTTGTACCACAAAGGCCTTCTAAAATTTGCTCTGCCTGCAGAATCTATCAGTGAGACTGTGGCAGTGTTTGTTGGGGACATGTCCAGACCCTGGACTATTATGGAATCACTGTTAAAGTGGGCAAGTGTTCTGCGAGAGCACATAGACAAACTGAAAATTCCTCCAGAGGAAATGCGAGAATTAGAACAAAAGATTATTAAGGATTTTCAGGAGTATGTTGAACCTGAAGAAGCACTCTCGGGATCACCACAGAGAAAAGGTCCTACATCATCTGGCACAGAGGACGAGAATATTGTCTTGCCTCTTGGGGATAGTAGTTTAACCACTCACCATGAAAATCCTGGATTTGTTGTTTGTGTTAGGTGTTATGCAGTCGGCGATTTTGTATTGGGAGCTGGCTACGAAGATGAACATTTTGAATTACTTCGGGGGCCCTTCCGGCGGTTTTGGCTTACGGA
Full Trace Sequence: CCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGGAGAGGAAGCTGCTGGGCGCTGACCGGGGGGATACTCCCGGAGCAGGCGACGAAGAAGACGAAGGGCAGAGCTTATGGTCTTCTATTCTCAGTGATGTTTCCACAAGCGCAAGATCGAAGTTACCCTCTGGGAAAAACATACTGGTATTTGGTGAAGATGGTTCAGGAAAGACCACTCTCATGGCAAAACTTCAAGGTGCCGAACACAACAAGAAAGGAAGGGGGCTTGAATATTTATACTTGAACATTCATGATGAAGATAGAGATGATCTCACACGTTGCAATGTGTGGATTTTGGATGGGGACTTGTACCACAAAGGCCTTCTAAAATTTGCTCTGCCTGCAGAATCTATCAGTGAGACTGTGGCAGTGTTTGTTGGGGACATGTCCAGACCCTGGACTATTATGGAATCACTGTTAAAGTGGGCAAGTGTTCTGCGAGAGCACATAGACAAACTGAAAATTCCTCCAGAGGAAATGCGAGAATTAGAACAAAAGATTATTAAGGATTTTCAGGAGTATGTTGAACCTGAAGAAGCACTCTCGGGATCACCACAGAGAAAAGGTCCTACATCATCTGGCACAGAGGACGAGAATATTGTCTTGCCTCTTGGGGATAGTAGTTTAACCACTCACCATGAAAATCCTGGATTTGTTGTTTGTGTTAGGTGTTATGCAGTCGGCGATTTTGTATTGGGAGCTGGCTACGAAGATGAACATTTTGAATTACTTCGGGGGCCCTTCCGGCGGTTTTGGCTTACGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGGAGAGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838066
dbEST ID: 79655768
Trimmed Sequence: GGCCTCATTCTCCGTTGTGGAAGAATTGGCTAACACAGTGTCTGGCTGGCAGGTCATCCTGTCCAGTTCCTCTTGGACATTGGTTAATACCGGCTTCTGGCCTGGCTTTTTGGCCACACCTTGTGCTGCTCCTCCTCCACCAGGGCTTCCGGGTGATCCAGTCTTTTTACTGAGCAGGCTGTTAAAAAAACTGGCCAGGACACCTTCACTGGCAGCTGCATTTTTAATGTTGGGGTCTGGCTTCTTGGCAGCTGCCATAGGTGAAGAACTGGGTACAGCATTTGGACCTGTTCTACCAGAAGTGCGGGGGGATCCTGTGGGAGCTCGAGCTGGGGACTCCGAGGCTCGTGTGGGAGTGGCTGGCTGCTTTGCTAAATAGGACTGTTGTTTCATTAAAAAGACTTGCTCGTCCTCAGCAGCAACTTCTTTGTCATGCACCAGCTTTCTAACAGGAGGTTTCACAATAAAATCTTCATAGGCATCTTCAGGTTTCACCGTTGAAAAGTTTTCATGCAAAATCCCAATTTTCTTCTCATTGTCCCAGCCAGCAAGAATAAACACGGAATCTTTCTCCACCACCATGGCAACACGATTAAAGTGAAAATTGTATGTTTTGTGTACAATGTACTTATACAGCAAATTCCGGTTTTTTTTCTTTCTTTACAAAAGTATAAATTTAGGGCAAAACCCATATTGGAAACCAAAATTTTCCGTATGTTAAAACATAAATGAAATTCCAAAGTGCCCATTTCTTTGTTAATTTAGT
Full Trace Sequence: CGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCCTCATTCTCCGTTGTGGAAGAATTGGCTAACACAGTGTCTGGCTGGCAGGTCATCCTGTCCAGTTCCTCTTGGACATTGGTTAATACCGGCTTCTGGCCTGGCTTTTTGGCCACACCTTGTGCTGCTCCTCCTCCACCAGGGCTTCCGGGTGATCCAGTCTTTTTACTGAGCAGGCTGTTAAAAAAACTGGCCAGGACACCTTCACTGGCAGCTGCATTTTTAATGTTGGGGTCTGGCTTCTTGGCAGCTGCCATAGGTGAAGAACTGGGTACAGCATTTGGACCTGTTCTACCAGAAGTGCGGGGGGATCCTGTGGGAGCTCGAGCTGGGGACTCCGAGGCTCGTGTGGGAGTGGCTGGCTGCTTTGCTAAATAGGACTGTTGTTTCATTAAAAAGACTTGCTCGTCCTCAGCAGCAACTTCTTTGTCATGCACCAGCTTTCTAACAGGAGGTTTCACAATAAAATCTTCATAGGCATCTTCAGGTTTCACCGTTGAAAAGTTTTCATGCAAAATCCCAATTTTCTTCTCATTGTCCCAGCCAGCAAGAATAAACACGGAATCTTTCTCCACCACCATGGCAACACGATTAAAGTGAAAATTGTATGTTTTGTGTACAATGTACTTATACAGCAAATTCCGGTTTTTTTTCTTTCTTTACAAAAGTATAAATTTAGGGCAAAACCCATATTGGAAACCAAAATTTTCCGTATGTTAAAACATAAATGAAATTCCAAAGTGCCCATTTCTTTGTTAATTTAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCCTCATTCTCCGTTGT