ORFeome > dynlrb2 ORF1 – XORFeome v1.0

dynlrb2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dynlrb2
Gene ID: 6255497
Gene Page ID: 491536
ORF Xenbase ID: 17273391

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133267
Original XGC clone length: 291

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ840219
dbEST ID: 79657921
Trimmed Sequence: ATGGCAGAAGTTGAGGAAACTCTAAAGAGGATCCAGTCCCACAAAGGAGTAATTGGAACTATAGTCGTGAATGCAGAAGGAATTCCAATAAGAACAACATTAGATAACTCCACTACAGTGCAATATGCTGGTCTCCTGCACCAGCTGTCAATGAAAGCCAAAAGCACAGTGAGAGATATTGACCCTCAAAATGACTTAACTTTTCTCAGGATTCGATCAAAGAAGCATGAGATAATGGTTGCTCCAGACAAAGAATATCTTTTGATTGTCATCCAGAATCCATCAGAATT
Full Trace Sequence: GGGCCTCTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGTTGAGGAAACTCTAAAGAGGATCCAGTCCCACAAAGGAGTAATTGGAACTATAGTCGTGAATGCAGAAGGAATTCCAATAAGAACAACATTAGATAACTCCACTACAGTGCAATATGCTGGTCTCCTGCACCAGCTGTCAATGAAAGCCAAAAGCACAGTGAGAGATATTGACCCTCAAAATGACTTAACTTTTCTCAGGATTCGATCAAAGAAGCATGAGATAATGGTTGCTCCAGACAAAGAATATCTTTTGATTGTCATCCAGAATCCATCAGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGACCGTAACTCAAAAACTCAAATGTTACAGTGCATTGGGAAATGGCGGGACAAAAGGAAAAAAATAGAAAAAAACGAAAATGGGGGTCCCGGATAACGGGGGGGGAAAAATGGGGGCAGCCCGAGGCCCCCCCACGGAGGTGGGGGGGTGGAAACCAGGAAGGAAAGGGGAAAGGGGGGGCCCCCCACGTGAGAAAACACCCCGGGGGGAGGGGGAGGGGCGGGAGTGTGGGGGGGGAGGATGGGTTTTCTTGGGGAAGTTTTTGCAAAAAACCCTCGGAAAACAACCCCCCGGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGTTGAGGAAACTCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ840218
dbEST ID: 79657920
Trimmed Sequence: TTCTNATGNATTCTGGATGACAATCAAAAAATATTCTTTGTCTGGAGCAACCATTATCTCATGCTTCTTTGATCGAATCCTGAGAAAAGTTAAGTCATTTTGAGGGTCAATATCTCTCACTGTGCTTTTGGCTTTCATTGACAGCTGGTGCAGGAGACCAGCATATTGCACTGTAGTGGAGTTATCTAATGTTGTTCTTATTGGAATTCCTTCTGCATTCACGACTATNGTTCCAATTACTCCTTTGTGGGACTGGATCCTCTTTAGAGTTTCCTCAACTTCTGCCATGG
Full Trace Sequence: GGCACTATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTGATANTNACCTGTTCNTTNCAACAAATTTATAANCAATGCTTTCTTATAATGCCAACTTTNTACAANAAANTTNNCAATTCTNATGNATTCTGGATGACAATCAAAAAATATTCTTTGTCTGGAGCAACCATTATCTCATGCTTCTTTGATCGAATCCTGAGAAAAGTTAAGTCATTTTGAGGGTCAATATCTCTCACTGTGCTTTTGGCTTTCATTGACAGCTGGTGCAGGAGACCAGCATATTGCACTGTAGTGGAGTTATCTAATGTTGTTCTTATTGGAATTCCTTCTGCATTCACGACTATNGTTCCAATTACTCCTTTGTGGGACTGGATCCTCTTTAGAGTTTCCTCAACTTCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATAATTGGAGTCAAATAAGAATATCTTTACGCGTTTCTAGGCAATGCGGGGCGGAAGGAAAAAAAAAACTCTATCGGCGACCGCGGTGGGGGTTGCCTGTTGTGGGAGGGGAAGGACCCAGGGGACGACACCCGTGACGAGAGGGGGCTCGACGTTTGAAGGATGTTGTGCGGGCGTGGCCCGATCTTTAAAAAACGTGAACGGGCCACGGGAGGAGGGGGGGTTTTTGGGGTGTGGAACGGTTCTTTTGGTGGGTTATTATGCCTTTTCCCCATCCACACGCGGGGGGCGTAACACGGCGGGCGGGGGGGTGTTTTATGGGGGGGAAAGAATAGTAAAGAGTTTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTGATGGATTCTGGATGAC