ORFeome > dynlt3 ORF1 – XORFeome v1.0

dynlt3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dynlt3
Gene ID: 865899
Gene Page ID: 489761
ORF Xenbase ID: 17273403

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082681
Original XGC clone length: 345

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ839759
dbEST ID: 79657461
Trimmed Sequence: ATGGAAGATCAGAACAAAGGAGAGACTGCATTCAATGGAGATGAAGCCAGTATTGTTGTGAAGGAGTGTGTAGATGTCATCTTGGGTGGAGTTGACTATGATGAGAATCGAATTAACGAGTGGATGTCAGCGGTGGTTGAACAGTCTTTAACACACCTAGTAAAGATGGGGAAAGCCTTTAAATACATTGTGTCCTGTACAGTGATGCAAAAACGGGGATCTGGTCTTCATGCTGCAAGTTCTTGTTTTTGGGATAACAACACCGATGGGAGCTGCACAGTGCGATGGGAAAACAGGACCATGTATTGCGTTGTCAGTGTGTTTGCTGTCGCCATCAACTTATT
Full Trace Sequence: TTCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGATCAGAACAAAGGAGAGACTGCATTCAATGGAGATGAAGCCAGTATTGTTGTGAAGGAGTGTGTAGATGTCATCTTGGGTGGAGTTGACTATGATGAGAATCGAATTAACGAGTGGATGTCAGCGGTGGTTGAACAGTCTTTAACACACCTAGTAAAGATGGGGAAAGCCTTTAAATACATTGTGTCCTGTACAGTGATGCAAAAACGGGGATCTGGTCTTCATGCTGCAAGTTCTTGTTTTTGGGATAACAACACCGATGGGAGCTGCACAGTGCGATGGGAAAACAGGACCATGTATTGCGTTGTCAGTGTGTTTGCTGTCGCCATCAACTTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAGATCTGAAACGTGTCTCAAAATCTTATATGTTACACCCAGCATCCAGGTAAAAAAGGGTCCAGTTCGAGGCTGGCCACGTAAAAAGTGAGGTGATTCGCGGGAACGGAATTAAGGACCAAACCATGGAAACAGGGCGGGTTGGACGTTGTCGTCATGGCCCGGGGGGTGGCCCCCCGCATGGGGGGCGAAACTTGACCAAAGAAGGGGGAGAAAGGAGGAGGGGGGGTTTTTTTGGTTGTGTATAAAAGTTTTTTTGGGGTTTTTTTTTTTTTCTTTTGTATTATAAAAGCCAACCCCTTTCTCCAATGGCGGGGTTGGCTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGATCAGAACAAAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839758
dbEST ID: 79657460
Trimmed Sequence: TAAGTTGATGGCGACAGCAAACACACTGACAACGCAATACATGGTCCTGTTTTCCCATCGCACTGTGCAGCTCCCATCGGTGTTGTTATCCCAAAAACAAGAACTTGCAGCATGAAGACCAGATCCCCGTTTTTGCATCACTGTACAGGACACAATGTATTTAAAGGCTTTCCCCATCTTTACTAGGTGTGTTAAAGACTGTTCAACCACCGCTGACATCCACTCGTTAATTCGATTCTCATCATAGTCAACTCCACCCAAGATGACATCTACACACTCCTTCACAACAATACTGGCTTCATCTCCATTGAATGCAGTCTCTCCTTTGTTCTGATCTTCCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAGTTGATGGCGACAGCAAACACACTGACAACGCAATACATGGTCCTGTTTTCCCATCGCACTGTGCAGCTCCCATCGGTGTTGTTATCCCAAAAACAAGAACTTGCAGCATGAAGACCAGATCCCCGTTTTTGCATCACTGTACAGGACACAATGTATTTAAAGGCTTTCCCCATCTTTACTAGGTGTGTTAAAGACTGTTCAACCACCGCTGACATCCACTCGTTAATTCGATTCTCATCATAGTCAACTCCACCCAAGATGACATCTACACACTCCTTCACAACAATACTGGCTTCATCTCCATTGAATGCAGTCTCTCCTTTGTTCTGATCTTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACAAGTCAGACGTATTACAAAAAATAGAACTGGGAACTGCAAAGCATCACGAAAAAAAAAAGCCCAATTCGAGACTGCAACAGCGGTGGTTTATTATTCGCGGTGAACGATAAAGGAATAAAACACAGCAACAAACACGGACTGAAACGTGTCGAGAGAGAACTTAGGGGGGGCGGCTCCCCACAGGGTCCAAAACCTGAACGAAACCAGACGGGGGAAGGGGCCGAGGGGGGGGGTCACGGGCGTGTTGTGTAAGATGTTTTTTTGGGTGGATCCTTCTTCCCCCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGTTGATGGCGACAGCAAA